We narrowed to 10,229 results for: EPO
-
Plasmid#74134PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 410 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcs2-HRI-GFP-IRES-mCherry
Plasmid#226099PurposeHRI stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-VEGF(Nb35) PAGER(TF)
Plasmid#230000PurposeExpresses anti-VEGF PAGER(TF) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-Nb35-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
VAMP8-mCherry
Plasmid#92424PurposeExpression of VAMP8 C-terminally conjugated to mCherry.DepositorInsertVAMP8 (Vamp8 Mouse)
TagsmCherryExpressionMammalianMutationA36S (Please see Depositor Comments below)PromoterCMVAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286A)
Plasmid#127390PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286A)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to AlaninePromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAN056
Plasmid#220052PurposeReporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (positive control).DepositorInsertfLuc-CFTR (exons 22-27) (CFTR Human)
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash1
Plasmid#74129PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 40 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash4
Plasmid#74132PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 225 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash3
Plasmid#74131PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 171 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT5-d2EGFP-mCherry
Plasmid#201454PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT5_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBA407-Neo-COVGT5-mCherry
Plasmid#201455PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT5_mCherry
UseLentiviral and Synthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG43
Plasmid#226736PurposeExpresses a reporter for an alpha-helical OMM proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
mKate2-P2A-APEX2-2xFYVE_hrs
Plasmid#67663PurposeMammalian expression vector driving APEX2-2xFYVE (2xMouse FYVE domain from HRS, [marks PI3P] fused to EM peroxidase marker). Also contains bicistronially expressed cytoplasmic red reporter.DepositorInsertmKate2-P2A-APEX2-2xFYVE
ExpressionMammalianPromoterCMVAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEMS2144
Plasmid#104357PurposeAAV plasmid with smCBA promoter driving expression of emerald GFP (EmGFP) reporterDepositorInsertssAAV-smCBA-EmGFP
UseAAVPromotersmCBAAvailable SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEND-224_Cacnes_sfGFP
Plasmid#225611PurposeReplicative vector for green fluorescent reporter protein sfGFP strong constitutive recombinant expression in C. acnes. pBRESP36A with P(BBa_J23119)+RBS_1+sfGFP.DepositorInsertsfGFP
UseSynthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)ExpressionMammalianAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-Ccnd2PromoterRegion2(0.5kb)
Plasmid#228059Purpose0.5 kb from mouse Ccnd2 promoter in front of firefly luciferase reporterDepositorInsertCcnd2 promoter (Ccnd2 Mouse)
UseLuciferaseAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-Igf2Promoter
Plasmid#228060Purpose0.9 kb from mouse Igf2 promoter in front of firefly luciferase reporterDepositorInsertIgf2 promoter (Igf2 Mouse)
UseLuciferaseAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only