We narrowed to 26,144 results for: Nov
-
Plasmid#118849PurposeExpresses human KIT K642E mutant and zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2K7-bsd-UBI-tagRFP-KDEL
Plasmid#114179PurposeLentiviral vector for expression of tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseLentiviralTagsKDEL retention signal and signal peptideExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
NKP38 GFP (1009)
Plasmid#62021Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-2xPH-TAPP1 R211L mutant
Plasmid#161991PurposeExpresses two mutated tandem repeats of Tapp1 PH domain (phosphoinositide binding-deficient mutant of TAPP1, R211L, can't bind PI(3,4)P2). Fused to eGFPDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GP-2-KDM4A double Tudor
Plasmid#59699PurposeContains histone modification interacting domain (KDM4A double Tudor)DepositorAvailable SinceOct. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-tagRFP-KDEL
Plasmid#114177PurposeGateway entry clone containing tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseGateway entry cloneTagsKDEL retention signal and signal peptideAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-hSox2
Plasmid#20073DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23A
Plasmid#201438PurposeExpresses human RAD23A with an N-terminal FLAG tag in mammalian cellsDepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TC1332
Plasmid#164874PurposeCURE-N: C to U RNA Editing, with high efficiency and low off-target effectsDepositorInserthAPOBEC3A fused to PspCas13b (APOBEC3A )
UseCRISPRExpressionMammalianMutationhuman apobec Y132DAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
Integrin beta5-2XEGFP
Plasmid#139779PurposeDetecting Integrin beta5 by fluorescence microscopyDepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-PIPK1 gamma 87
Plasmid#22300DepositorInserthuman phosphatidylinositol phosphate kinase type 1 gamma 87 (PIP5K1C Human)
TagsGFPExpressionBacterial and MammalianAvailable SinceDec. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pKS022 - pCAGGS-3XFLAG-mKate2-SA2-bpA
Plasmid#156441PurposeFor transient expression of mouse SA2 (STAG2 or SCC3B) tagged with mKate2DepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-ET
Plasmid#72542Purposeexpresses FLAG tagged human BRD4 ET domain (608-699 aa)DepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp16-HF
Plasmid#157725Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp16 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
SMC2-mAC donor (Hygro)
Plasmid#140648PurposeSMC2 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only