We narrowed to 29,804 results for: promoter
-
Plasmid#44467PurposeExpresses a luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutationDepositorInsertA luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutation
UseLuciferase; Plant transformationMutationA disruption was made between the first and secon…Promoter35S PromoterAvailable SinceApril 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFGL821-8
Plasmid#58224PurposeFor fungal transformation via ATMT. Transformants to be selected by hygromicin resistance.DepositorInserthygromycin B phosphotransferase
ExpressionBacterialPromoterAspergillus nidulans trpC promoterAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLMB51
Plasmid#40083DepositorInsertsgusA
tauR
tau promoter
ExpressionBacterialAvailable SinceNov. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMT-Flag-RELISH
Plasmid#63750PurposeExpresses drosophila RELISH tagged with a Flag epitopes, under control of metallothionein promoterDepositorAvailable SinceApril 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTLNX
Plasmid#49032PurposeFX cloning Xenopus oocyte expression vector with SP6 promoterDepositorTypeEmpty backboneUseXenopus oocytes expressionPromoterSP6Available SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pbacNeoR
Plasmid#26349DepositorInsertBacterial promoter::NeoR::bacterial 3p flank
ExpressionBacterialAvailable SinceDec. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGRE GFP
Plasmid#1196DepositorInsertGFP w/ stop codon
ExpressionYeastMutationGFP w/ stop codonAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJRL2 PHO5pr VYFP (EB#1547)
Plasmid#14840DepositorAvailable SinceMay 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/hpa5
Plasmid#59972Purposeintegrin a5 wild-type headpiece expression (a5 beta-propeller and a5 thigh domain)DepositorInserthuman integrin a5 headpiece (ITGA5 Human)
Tagsacid coiled-coil and StrepII tagExpressionMammalianPromoterCMV promoterAvailable SinceOct. 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muHRNR-X50
Plasmid#59451PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of mouse HMR.DepositorAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
p2HGPD/ER/cyc
Plasmid#1283DepositorInsertER
TagsGpd promoterExpressionYeastAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJRL2 GAL1pr VYFP (EB#1571)
Plasmid#14847DepositorAvailable SinceMay 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNNS2-ySEc
Plasmid#26757DepositorInsertYFP, CFP and gal promoters
ExpressionBacterialAvailable SinceApril 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRB2953
Plasmid#8674DepositorAvailable SinceJune 30, 2005AvailabilityAcademic Institutions and Nonprofits only -
CJ30 (miR-1003 minigene)
Plasmid#17767DepositorInsertdme-miR-1003 minigene
UseDrosophila p-element vectorAvailable SinceMay 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-CasRx-tagBFP-PGK-Blasticidin
Plasmid#187952PurposeFKBP12 (F36V mutant) degron-tagged CasRx fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-CasRx-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linker, HA-tag, and NLSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only