We narrowed to 12,981 results for: NUC
-
Plasmid#193351PurposeRetroviral vector expressing human SOX2DepositorAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP TEM4 R130D
Plasmid#58895PurposeExpresses GFP Tagged full length TEM4 protein with R130D mutation. Please see notes below for information regarding the L722F mutation in TEM4.DepositorAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb1
Plasmid#162793PurposeCcnb1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ239-RR
Plasmid#108862PurposeFnCpf1 Gateway entry plasmid with N623R and K687R mutationsDepositorInsertFnCpf1-RR (FnCpf1 with N623R and K687R mutations)
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationN623R and K687R, Cpf1 is rice codon optimizedAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
HOXB3 (human) FLAG pSP65
Plasmid#8523DepositorInsertHOXB3 (HOXB3 Human)
UseIn vitro transcription/translationTagsFLAGExpressionBacterialMutationContains 5 additional amino acids before ATG from…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-LC3-K51A
Plasmid#155265PurposeMammalian expression of rat LC3 fused to EGFPDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
TagspEGFPExpressionMammalianMutationLysine 51 to AlanineAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-LC3-R70A
Plasmid#155264PurposeMammalian expression of rat LC3 fused to EGFPDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
TagspEGFPExpressionMammalianMutationArginine 70 to AlanineAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.Ollas.S_mCherry-NLS
Plasmid#178279PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.S.V5_mCherry-NLS
Plasmid#178278PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.S.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.V5_mCherry-NLS
Plasmid#178277PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.S_mCherry-NLS
Plasmid#178273PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AviMta3-3xFiBsd
Plasmid#140962Purposefull-length wt Avi-Mta3-3XFLAG-iBsd cDNA w/CAG promoter and Blasticidin resistance, cloned from mouse ES cellsDepositorInsertmetastasis associated 3 (Mta3 Mouse, Synthetic)
Tags3xFLAG, Avi, and TEVExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 S449A/T450A/S454A
Plasmid#19845DepositorInsertMKL1 S449A/T450A/S454A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Serine 449, Threonine 450 and Serine 454 …Available SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-cytoBirA-2A-mCherry_Ras
Plasmid#80064PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Dnmt3b6-Poly(A)
Plasmid#65532PurposePlasmid for Bxb1-mediated recombination of the GFP-Dnmt3b6 cDNA into a MIN-tagged locusDepositorInsertDnmt3b (Dnmt3b Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationisoform 6Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/Flag-hINO80N2 (1-406)
Plasmid#29442DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
EF1a_DIO_R133C-HaloTag
Plasmid#164064PurposeDouble-Floxed Inverted Open reading frame for mouseMeCP2(alpha) carrying R133C mutationDepositorAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Ctdnep1_D67E-2xFlag
Plasmid#196519PurposeExpression of Ctdnep1_D67E-2xFlagDepositorInsertCtdnep1_D67E-2xFlag (CTDNEP1 Human)
Tags2xFlagExpressionMammalianMutationD67E mutation (phosphastase dead)PromoterCMV promoter; T7 promoterAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only