We narrowed to 1,002 results for: plasmids spcas9
-
Plasmid#113041PurposeAAV vector; encodes GFP as well as a U6-driven CCR5-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA CCR5 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-EMX1 gRNA (SpyCas9 scaffold)
Plasmid#113040PurposeAAV vector; encodes GFP as well as a U6-driven EMX1-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA EMX1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CFTR gRNA (SpyCas9 scaffold)
Plasmid#113042PurposeAAV vector; encodes GFP as well as a U6-driven CFTR-targeting gRNA (SpyCas9 scaffold)DepositorInsertCFTR gRNA (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
SIN-CMV-Ca9-WPRE
Plasmid#87874PurposeTransfer plasmid for the production of lentiviral vectorsDepositorInsertspCas9
UseLentiviralTagsnlsMutationHuman codon-optimizedPromoterCMVAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_mouseH3.1
Plasmid#244241PurposeExpresses SpCas9 and a sgRNA targeting the mouse histone H3.1 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_H3.2
Plasmid#244239PurposeExpresses SpCas9 and a sgRNA targeting the human histone H3.2 loci for knock-in.DepositorUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1
Plasmid#218156PurposeThis plasmid harbors the base editor SCBE3-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-Hypa
Plasmid#218157PurposeThis plasmid harbors the base editor SCBE3-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-MM002-ZFP143-C-terminal-sgRNA
Plasmid#212706PurposePlasmid for transient expression of pspCas9(BB)-2A-Puro nuclease and sgRNA targetting the C terminal of Zfp143 locusDepositorInsertZFP143 C-terminal sgRNA (Zfp143 Mouse)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only