We narrowed to 13,472 results for: sequence
-
Plasmid#65331Purposestandard plasmids for exogenus pathway assembly haboring recombination sequence 1(Universal Recombination Region 1) which could be released and ligated to series of TUsDepositorInsertURR1
UseSynthetic BiologyAvailable SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sdk1-AP-His
Plasmid#72008PurposeExpresses the extracellular region of the Sdk1 protein (endogenous signal peptide replaced with CD33 signal peptide), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
P12-bio
Plasmid#47725PurposeExpresses enzymatically monobiotinylated full-length P12 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P12
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sdk1-Fc-His
Plasmid#72134PurposeExpresses the extracellular region of the Sdk1 protein (endogenous signal peptide replaced with CD33 signal peptide), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
(81) pcDNA3.1-BC2-Nup62-Flag-EPEA
Plasmid#168094PurposeNucleoporin Nup62 with N-terminal BC2 nanobody tag and C-terminal Flag and EPEA nanobody tagsDepositorInsertNup62-Ubc-Flag-EPEA
TagsBC2-Tag, EPEA-tag, and Flag-tagExpressionMammalianMutationP229A, S283T on Nup62 native sequencePromoterT7/CMVAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
CLAG3.2-bio
Plasmid#47797PurposeExpresses enzymatically monobiotinylated full-length CLAG3.2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised CLAG3.2
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LLP251 pEF1a-UNC5C-4-SunTag
Plasmid#100940PurposeTALE vector with UNC5C-4 insert fused to SunTagx10, driven by EF1a, with 3xHA tag, no PURO geneDepositorInsertTALE target sequence for UNC5C, SunTag array (10xGCN4)
UseTALENTags3xHAExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ntn5.a-AP-His
Plasmid#71981PurposeExpresses the entire Netrin 5, isoform a protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3E DN Kif5a
Plasmid#105973Purpose3' element for Gateway cloning, 5 single nucleotide mutations compared to the reference sequence, but none of them change the amino acidtruncation aa416-1033(end) 1854 bpDepositorAvailable SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Plxna3-AP-His
Plasmid#71998PurposeExpresses the extracellular region of the PlexinA3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-C02
Plasmid#46563PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (CMVwt CAAT box mutant).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-C18
Plasmid#46560PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (CMVwt CAAT box mutant).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTrc99S-ssDsbA-PorA-4xDQNAT
Plasmid#128400PurposePeriplasmic expression of N. meningitidis PorA with C terminal 4xDQNAT glycosylation sites in E. coliDepositorInsertN. meningitidis PorA
Tags4xDQNAT glycosylation tag, 6xHis tag, and DsbA si…ExpressionBacterialPromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
ASP-bio
Plasmid#47745PurposeExpresses enzymatically monobiotinylated full-length ASP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised ASP
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RAP1-bio
Plasmid#47794PurposeExpresses enzymatically monobiotinylated full-length RAP1 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RAP1
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RhopH2-bio
Plasmid#47798PurposeExpresses enzymatically monobiotinylated full-length RhopH2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RhopH2
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Rgma-AP-His
Plasmid#72007PurposeExpresses the extracellular region of the RGMa protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema5b-AP-His
Plasmid#72036PurposeExpresses the extracellular region of the Sema5B protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only