We narrowed to 20,649 results for: Nes
-
Plasmid#31390DepositorInsertaph
UseCre/LoxAvailable SinceApril 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCGN-ELK-1 R mut
Plasmid#27159PurposeFor mammalian expression of human Elk-1 with an HA tag and a mutation in the R repression domainDepositorAvailable SinceFeb. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
L3MBTL2
Plasmid#25244PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceAug. 13, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
PsbA2-HMGS-HMGR-ATOB-NPTI
Plasmid#73338PurposeConstruct expressing the upper MVA pathway in Synechocystis PCC 6803DepositorInsertHMGS-HMGR-ATOB-NPTI
PromoterpsbA2Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS303-pGAL-SPPHO5-G-SrtAstrep-HA-HDEL (pKS82)
Plasmid#50032PurposeGalactose-inducible expression of ER-luminal S. pyogenes SrtA in yeastDepositorInsertHA-SrtA(strep)
TagsHA-HDELExpressionYeastPromoterpGALAvailable SinceJan. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLenti_CMV:Flag-GpNLuc
Plasmid#208840PurposeExpresses FLAG epitope-tagged GpNLuc "Green" BRET reporter in mammalian cells.DepositorInsertGpNLuc LumiFluor
UseLentiviralTags1xFLAGExpressionMammalianPromoterCMVAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1277 - pAAV-AiE2051m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214479PurposeAiE2051m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1858 - pAAV-AiE2538m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214558PurposeAiE2538m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-GFP-RELA
Plasmid#196629PurposeExpress GFP-RELADepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCVhyg-HA-FLAG_Ubc9_WT
Plasmid#164936PurposeExpresses FLAG & HA tagged human uman Ubiquitin Conjugating Enzyme 9 (UBC9) wild type cDNADepositorAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0378
Plasmid#133229PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter pNeo (pOGG001), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-mROCK1-delta6
Plasmid#101294PurposeMammalian expression of Rock1-GFP for the study of localisation signaling.DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3044(gRNA XI-2)
Plasmid#73286PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only