We narrowed to 11,432 results for: 110
-
Plasmid#242000PurposeLentiviral plasmid for generation of cell lines stably expressing NG-ABE8e base editor. NG-ABE8e expression can be followed by GFP fluorescence. Contains PGK-puromycin resistance cassette.DepositorInsertNG-ABE8e
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mStayGold-WPRE (JDW 1384)
Plasmid#242550PurposeGateway middle entry clone containing H2B-mStayGold with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmStayGold (monomeric StayGold)
UseGateway subcloningTagsExpressionMutationPromoterAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mBaoJin-WPRE (JDW 1383)
Plasmid#242549PurposeGateway middle entry clone containing H2B-mBaoJin with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmBaoJin
UseGateway subcloningTagsExpressionMutationPromoterAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-mCerulean3-TUBB1A (JDW 1508)
Plasmid#242555PurposeGateway middle entry clone containing mCerulean3-TUBB1A; Cyan fluorescent reporter for visualizing tubulin in cellsDepositorInsertmCerulean3-TUBB1A
UseGateway subcloningTagsExpressionMutationPromoterAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT1AR gRNA (5-HT1A Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA2 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT7R gRNA (5-HT7 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNUP98n-CAGEn-NES (Nrdj1) (NUP98 Human, Synthetic)
UseTagsMycExpressionMammalianMutationPromoterCMVAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
M7138
Plasmid#219774PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of ORCA3 promoter and terminatorDepositorInsertpNOS-HygR-ocsT | pORCA3-nnLuz-ORCA3_T
UseSynthetic BiologyTagsExpressionPlantMutationPromoterpNOS-HygR-ocsT | pORCA3-nnLuz-ORCA3_TAvailable sinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
M7691
Plasmid#219775PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of WRKY70 promoter and terminatorDepositorInsertpNOS-HygR-ocsT | pWRKY70-nnLuz-WRKY70_T
UseSynthetic BiologyTagsExpressionPlantMutationPromoterpNOS-HygR-ocsT | pWRKY70-nnLuz-WRKY70_TAvailable sinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK3558
Plasmid#219776PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of p35S promoter and act2 terminatorDepositorInsertpNOS-HygR-ocsT | p35S-nnLuz-act2
UseSynthetic BiologyTagsExpressionPlantMutationPromoterpNOS-HygR-ocsT | p35S-nnLuz-act2Available sinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID-ER
Plasmid#240230PurposeExpression of ER-localized sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBIP-sfGFP-TurboID-KDEL
UseTagsExpressionInsectMutationPromoterMTAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID
Plasmid#240231PurposeExpression of sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertsfGFP-TurboID
UseTagsExpressionInsectMutationPromoterMTAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3-ER
Plasmid#240234PurposeExpression of ER-localized Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBiP-Myc-BirA*G3-KDEL
UseTagsExpressionInsectMutationPromoterMTAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionInsectMutationPromoterAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only