We narrowed to 8,708 results for: sgRNA
-
Plasmid#169941PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tRFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRTagsExpressionMutationPromoterhU6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorInsertPspCas9 gRNA targeting Mettl3 C-terminus (Mettl3 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC2_10_dCas9_VPR_HC_sgRNA
Plasmid#163712PurposeYeast high copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SpCas9_sgRNA_expression_in_pBluescript
Plasmid#122089PurposeU6 driven SpCas9 sgRNA expression vector for cloning own guidesDepositorInsertSpCas9 tracr (NEWENTRY Synthetic, S. pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available sinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_Dual_sgRNA
Plasmid#173202PurposeCoselection for PE3 or HDR in human cells. Vector for tandem expression of ATP1A1 G3 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
NmCas9_sgRNA_expression_in_pBluescript
Plasmid#122091PurposeU6 driven NmCas9 sgRNA expression vector for cloning own guidesDepositorInsertNmCas9 tracrRNA (NEWENTRY Synthetic, S. pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBP_sgRNA
Plasmid#190128PurposeLevel 0 MoClo plasmid for Golden Gate cloning of sgRNAsDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_G3BP1_G1
Plasmid#127114DepositorInsertgRNA G3BP1 (G3BP1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7sgRNA
Plasmid#111820PurposeExpresses sgRNA in T. brucei cellsDepositorInsertsgRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_2
Plasmid#155085Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G2_Dual_sgRNA
Plasmid#173201PurposeCoselection for ABE or NHEJ in human cells. Vector for tandem expression of ATP1A1 G2 sgRNA with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC_sgRNA
Plasmid#68710PurposeContains the sgRNA backbone sequence (tracrRNA, 82 bp) and is used as DNA template to amplify a specific sgRNA using a forward primer with the protospacer sequence for gene targeting.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.GFP
Plasmid#169938PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and GFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
p184_LTJ_sgRNACD90.2
Plasmid#82670PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD90.2
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TRIM25_G1
Plasmid#127119DepositorInsertgRNA TRIM25 (TRIM25 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSGKP_AcsgRNA
Plasmid#203807PurposepSGKP-based plasmid containing a J23119-driven sgRNA cassette, with replaceable spacer (BsaI-restriction sites). Kanamycin resistance.DepositorInsertAcgRNA
UseCRISPRTagsExpressionMutationPromoterJ23119Available sinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only