We narrowed to 13,472 results for: sequence
-
Plasmid#47791PurposeExpresses enzymatically monobiotinylated full-length PF3D7_1431400 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PF3D7_1431400
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-WT
Plasmid#85847PurposeDonor plasmid for SNCA exon3 wild type sequence. lso contains TagBFP and dTomatoDepositorInsertSNCA exon 3 homology arms (SNCA Human)
ExpressionBacterial and MammalianAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-2X
Plasmid#110835PurposeCMV expression vector for BE3-2X construct (not codon optimized)DepositorInsertBE3-2X
ExpressionMammalianMutation2 tandem NLS sequences in the XTEN linkerPromoterCMVAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-FNLS
Plasmid#110836PurposeCMV expression vector for BE3-FNLS construct (not codon optimized)DepositorInsertBE3-FNLS
Tags3X FLAGExpressionMammalianMutationNLS sequence at the N-terminusPromoterCMVAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.a-AP-His
Plasmid#71994PurposeExpresses the extracellular region of the Netrin G2, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3XFLAG-MKK7-EE-NLS hygro
Plasmid#87780PurposeInducible expression of constitutively active mutant MKK7 with a C-terminal NLS sequenceDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
RGS-6xHis-BLMP-1-pcDNA3.1-
Plasmid#52514Purposeexpresses C. elegans BLMP-1 in mammalian cells with RGS-6xHis tag at N-terminusDepositorInsertblmp-1 (blmp-1 Nematode)
Tags6xHisExpressionMammalianMutationN75S mutation compared GenBank reference sequence…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.d-AP-His
Plasmid#71987PurposeExpresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.3-Fc-His
Plasmid#72100PurposeExpresses the extracellular region of the Neuropilin 2, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.4-Fc-His
Plasmid#72101PurposeExpresses the extracellular region of the Neuropilin 2, isoform 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Neo1.c-AP-His
Plasmid#71965PurposeExpresses the extracellular region of the Neogenin 1, isoform c protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnb2(L)-AP-His
Plasmid#72002PurposeExpresses the extracellular region of the PlexinB2 protein (ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.c-Fc-His
Plasmid#72112PurposeExpresses the extracellular region of the Netrin G1, isoform c protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-A18G-B/c
Plasmid#246716PurposeCloning amiRNA sequences in AtMIR390a-A18G precursors for in planta expressionDepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation & chloramphenicol-ccdB cassette flanked by two BsaI sites (MIR390a Mustard Weed)
UseRNAiExpressionPlantAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-GFP-WPRE-miR124T
Plasmid#245069PurposeFluorescent reporter gene with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertEGFP, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
ER-GFP pLVX CMVpuro
Plasmid#246912PurposeLentiviral-based expression of EGFP with an ER retention signal sequence in mammalian cellsDepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4866 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF1a in MGEV
Plasmid#244190PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF1aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF1 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4864 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF6a in MGEV
Plasmid#244189PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF6aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF6 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28a_VIM-2
Plasmid#242840PurposeExpresses His6-TEV-VIM-2 in bacteria, comprising a His6-tag, the Tobacco etch virus (TEV) cleavage site “ENLYFQ/G", and the VIM-2 sequence (UniPROT Q5U7L7)DepositorInsertMetallo-beta-lactamase VIM-2
TagsHis6 + Tobacco etch virus (TEV) cleavage site “EN…ExpressionBacterialMutationdeleted residues 1-26PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only