We narrowed to 15,442 results for: grn
-
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSGAb-spe
Plasmid#122000PurposeA sgRNA expression plasmid for genome editing in Acinetobacter baumanniiDepositorInsertnone
UseCRISPRAvailable sinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSUPER.PKCzeta.RNAi
Plasmid#10803DepositorAvailable sinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCR8-attL3-pegRNA-attL2
Plasmid#213052PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL3 and attL2DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-GFP>BFP_Y66H-NGG
Plasmid#185480PurposepegRNA plasmid in order to make a Y66H (TAC>CAT) conversion in the GFP gene, creating a BFP gene.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGFP>BFP_Y66H-pegRNA
ExpressionMammalianPromoterU6Available sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
HH-gRNA-HDV-Shuttle-Vector
Plasmid#169098PurposeBackbone plasmid to generate HH-gRNA-HDV segmentDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHH-gRNAbackbone-HDV
ExpressionMammalianPromoterNAAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNTI661 pRPR1(TetO)-sgRNA
Plasmid#139475PurposeVector for tet-regulated sgRNA expression in yeastDepositorInsertsingle guide RNA scaffold
UseCRISPRExpressionYeastPromoterpRPR1(TetO)Available sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLH-sgRNA1-boxB-MS2
Plasmid#75396PurposesgRNA1-boxB-MS2DepositorInsertsgRNA1-boxB-MS2
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHKMC1: Empty sgRNA for Cloning
Plasmid#67720PurposeEmpty vector for cloning sgRNA. NotI and BamHI for cloning sgRNA. PU6 driven sgRNA.DepositorTypeEmpty backboneExpressionWormPromoterPU6Available sinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPR-Cas9-ScaligD
Plasmid#125688PurposeGene knockout/in for actinomycetesDepositorInsertstreptomyces codon optimized spCas9, sgRNA casette, and ScaligD
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable sinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MSCV P2Gm FF
Plasmid#19750DepositorInsertoligo targeting Firefly luciferase
UseRNAi and RetroviralExpressionMammalianAvailable sinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pORANGE GFP-Camk2a KI
Plasmid#131484PurposeEndogenous tagging of CaMKIIa: N-terminal (amino acid position: before startcodon)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiGuide-Hygro-iRFP670
Plasmid#99377PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A iRFP670 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-iRFP670
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAW014-2
Plasmid#85612PurposeMulti-gRNA delivery vector containing ugtP-gRNA.P395T for Bacillus subtilisDepositorInsertugtP-gRNA.P395T
ExpressionBacterialAvailable sinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMKO.1-Puro-shPP2A-Aalpha
Plasmid#15249DepositorPublicationInsertPP2A regulatory subunit A, alpha isoform (PPP2R1A Human)
UseRNAi and RetroviralExpressionMammalianAvailable sinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-FLEX-SaCas9-U6-sgSlc32a1
Plasmid#159905PurposeMutagenesis of Slc32a1DepositorInsertSlc32a1 (Slc32a1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9cur
Plasmid#71538PurposeConstitutive expression of Cas9 gene and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli.DepositorInsertsCas9
Plasmid curing system
UseCRISPRExpressionBacterialPromoterpBADAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRetroSuper Smad3
Plasmid#15726DepositorPublicationAvailable sinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by