We narrowed to 10,545 results for: iCre
-
Plasmid#123235PurposeExpresses mCherry-EGFP-LC3B G120A in mammalian cells. Negative control for tandem reporter. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
RUSH reporter-HMGB1-SBP-GFP
Plasmid#172357PurposeMonitoring of HMGB1 subcellular localization by fluorescence videomicroscopyDepositorAvailable SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
LCV2 cGAS KO
Plasmid#217444PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human cGASDepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-sfCherry2ΔN12
Plasmid#231551PurposeMammalian expression of actin-binding Affimer6 fused to N-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagssfCherry2ExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-LC3B G120
Plasmid#123241PurposeExpression vector with PGK promoter for low expression of EGFP-LC3B G120. For lentivirus production and stable transduction in mammalian cells.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseLentiviralTagsEGFPExpressionMammalianMutationDeleted amino acids 121-125. Stop codon after G12…PromoterPGKAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-mScarlet
Plasmid#191098PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-GFP-PGK-Puro
Plasmid#110863PurposeLentiviral vector for constitutive expression of Cas9-HF1-P2A-GFP (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-SVI-DIO-dCas9-KRAB-MeCP2
Plasmid#170378PurposeExpresses a SYN-driven, intron-containing dCas9-KRAB-MeCP2 fusion in which the part of the dCas9 cassette is double floxed and in inverted orientation (DIO). Requires Cre-dependent recombination.DepositorInsertA DIO FLAG-dCas9-KRAB-MeCP2 cassette containing an SV40 intron
UseCRISPR, Cre/Lox, and LentiviralTagsFLAGExpressionMammalianPromoterhuman Synapsin promoterAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-miRFP-MAP4-MTBD
Plasmid#171487PurposeT7 promotor drives in vitro transcription of miRFP-tagged mouse MAP4-Microtubule Binding Domain mRNADepositorAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hTGM1-Flag
Plasmid#180406Purposelentiviral transduction of human TGM1 (with a C-terminal Flag tag) geneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-mScarlet-MAP4-MTBD
Plasmid#171488PurposeT7 promotor drives in vitro transcription of mScarlet-tagged mouse MAP4-Microtubule Binding Domain mRNADepositorAvailable SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-vsfGFP-0
Plasmid#191097PurposeTo express a bright green nanobody FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-vsfGFP-0
UseAAVTagsGreen fluorescent protein bound to enhancer nanob…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCC_10 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dCas9NG-NLS-2A-Puro-WPRE
Plasmid#139095PurposeExpresses human codon-optimized inactive SpCas9-NG fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dSpCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, L1111R, D1135V,G1218R, E1219F, A1322…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNluc-sgControl
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
LCV2_LacZ_sgRNA_2
Plasmid#155093Purposelentiviral plasmid expressing Cas9 and gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available SinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCC_04 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9NG-NLS-2A-Puro-WPRE
Plasmid#139089PurposeExpresses human codon-optimized xCas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationA262T,R324L, S409I, E480K, E543D, M694I, L1111R, …Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-xFNLS-P2A-Puro
Plasmid#110872PurposeLentiviral vector for constitutive expression of xFNLS in mammalian cells (codon optimized)DepositorInsertxFNLS(3.7)
UseLentiviralTags3X FLAGMutationD10A, A262T, R324L, S409I, E480K, E543D, M694I, E…PromoterEF1sAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only