We narrowed to 2,809 results for: quo
-
Plasmid#174535PurposePUb-mTurquoise fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-mTurquoise BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)Stop in pcDNA1/amp
Plasmid#60893PurposeThis vector attached CFP(159-238) to the C-terminus of a protein.DepositorInsertCFP(159-238)Stop
ExpressionMammalianMutationAsn-164 was changed to HisPromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
EphA2-MT
Plasmid#108851PurposeEncodes for human EphA2 fluorescently labeled with mTurquoise on the C-Terminus via a 15 amino acid (GGS)5 flexible linkerDepositorInsertEPHA2 (EPHA2 Human)
TagsLabeled with mTurquoise on the C-Terminus via a 1…ExpressionMammalianAvailable SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
aP2-GFPtpz
Plasmid#114211PurposeaP2/Fabp4 promoter driving GFPtopaz for labeling differentiated adipocytes and macrophageDepositorInsertaP2 promoter + pOB4 + eGFPtopaz (Fabp4 Aequorea victoria, Synthetic, Mouse)
TagsNoneExpressionMammalianPromoteraP2/Fabp4Available SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarR
Plasmid#31222DepositorInsertCD4-tdTom (CD4 Aequorea victoria, Fly, Human)
TagsCD4 and tdTomatoExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HemmarG
Plasmid#31221DepositorInsertCD4-tdGFP (CD4 Aequorea victoria, Fly, Human)
TagsCD4 and EGFP/GFPExpressionInsectMutationFusion of signal peptide of Drosophila Akh gene, …Available SinceOct. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-3UAG
Plasmid#82501PurposeExpresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153DepositorInsertGreen Fluorescence Protein with 3 UAG codons
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3, …PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIP7-RLuc-YFP-pBS
Plasmid#72482PurposeExpresses a renilla luciferase-YFP fusion protein under control of the rat insulin 2 gene promoter (RIP7) suitable for transfection or generation of transgenic animalsDepositorInsertsUseLuciferaseTagseYFP and renilla luciferaseExpressionMammalianMutationeYFP varientAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-RGS7
Plasmid#55760PurposeAn amino-terminal mCerulean fragment was fused to RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertmCer(1-158)-RGS7 (RGS7 Aequorea victoria, Human)
TagsCer(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationRGS7 was amplified via PCR, which added an N-term…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
TagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL1180-HR-PUbECFP
Plasmid#47917PurposeDonor plasmid for homologous recombination that expresses ECFP consitutively using the Aedes aegypti polyubiquitin (PUb) promoter.DepositorInsertECFP
TagsNLSExpressionInsectPromoterAedes aegypti polyubiquitin (PUb)Available SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry
Plasmid#50459PurposeDouble floxed mCherry under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertmCherry
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP
Plasmid#50457PurposeDouble floxed EGFP under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
Bsrs078-TraR(W)
Plasmid#85151PurposeConstitutively expresses TraR(W)DepositorInsertTraR(W)
Available SinceNov. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pCI_FLAG-GFP(Y39TAG)-6His
Plasmid#223507PurposeFluorescent reporter plasmid for genetic code expansion which consists of a modified GFP with a Amber stop codon on position Y39DepositorInsertGFP(Y39TAG)
Tags6xHis and FLAGExpressionMammalianMutationY39TAGAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Zeo-BFP-P2A-ppViperin
Plasmid#217482PurposeExpression of Blue Fluorescent Protein - P2A - medium length protein kinase R from chinook salmonDepositorInsertBFP-P2A-otPKRML
ExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only