We narrowed to 25,345 results for: spr
-
Plasmid#165071Purposeoverexpression of PspCas13b in human cellsDepositorInsertPspCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_TUBA1B sgRNA / hSpCas9
Plasmid#172834PurposeMammalian expression of a sgRNA targeting the intron 1 of TUBA1B (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of TUBA1B under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.0-Pct5.1-crRNA(AarI)
Plasmid#191633PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(nontargeting spacer), entry plasmid for crRNA cloningDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-TJP1
Plasmid#227300PurposeDonor template for mStayGold insertion into the N-terminus of the TJP1 locus. For tight junction visualization. To be co-transfected with sgRNA plasmid px330-TJP1 (Addgene #227299)DepositorInsertTJP1 Homology Arms flanking a mStayGold Tag (TJP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMD19_STARR-seq_plants
Plasmid#117379PurposeSTARR-seq vector with 35s core promoter for transient expression in plant protoplastsDepositorTypeEmpty backboneTagsGFP derived from pMDC107ExpressionPlantPromoter35s core promoterAvailable SinceNov. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-PguCas13b-msfGFP-NES-Flag
Plasmid#165072Purposeoverexpression of PguCas13b in human cellsDepositorInsertPguCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330a dCas9-VP64
Plasmid#92363PurposeModified CAG promoter-containing vector for ubiquitous expression of catalytically inactive Cas9 fused to VP64 transcriptional activation domain. For targeted gene activation in chicken embryos.DepositorInsertdCas9-VP64
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
AA030
Plasmid#216010PurposeFragmid fragment: (Cas protein) nickase Cas for base editingDepositorHas ServiceCloning Grade DNAInsertnCas9-SpG (D10A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-VdC9BV
Plasmid#62195PurposeExpresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous GenesDepositorInsertVP64dCas9BFPVP64
UseLentiviralTagsTwo VP64s tagged to dCas9 fused to BFPExpressionMammalianMutationD10A H840A (catalytically inactive) Cas9 (dCas9)Available SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCFD5-U6-3-t-attP40
Plasmid#133561PurposegRNA vector for targeting near the attP40 locus, use with pHD-3XP3-dsRed-DattP-CRISPR-donor-attP40 based constructsDepositorInsertattP40 region guide RNAs
UseCRISPRExpressionInsectPromoterU6Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-SpCas9-BlastR
Plasmid#107190PurposeConfers constitutive expression of SpCas9DepositorInsertSpCas9 (NEWENTRY )
UseCRISPRTags3xFLAGExpressionBacterial and MammalianPromoterChicken ß-actinAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-mTagBFP2-2A-Puro_hU6-RfxDR36-BsmBI
Plasmid#226011PurposeCasRx guide RNA cloning backbone (lenti)DepositorTypeEmpty backboneUseLentiviralAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcU6_1 sgRNA
Plasmid#92395PurposeChicken-specific U6 sgRNA expression mini-vector, harbouring chick U6_1 pol III promoter.DepositorInsertchick U6.1 promoter and gRNA cloning cassette
UseCRISPRExpressionMammalianPromoterchick U6.1Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
AA028
Plasmid#216008PurposeFragmid fragment: (Cas protein) nickase Cas for base editingDepositorHas ServiceCloning Grade DNAInsertnCas9 (D10A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA029
Plasmid#216009PurposeFragmid fragment: (Cas protein) nickase Cas for base editingDepositorHas ServiceCloning Grade DNAInsertnCas9-NG (D10A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA304
Plasmid#216072PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v1; trRNA_v1 [Sa]; terminator_v1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p207-Switch-ON (FRT)
Plasmid#217886PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only