We narrowed to 14,522 results for: SHR
-
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
ch-TOGKDP-GFP
Plasmid#69112PurposeFor mammalian expression of knockdown-proof human ch-TOG tagged with EGFP.DepositorInsertColonic Hepatic Tumour Over-expressed Gene (CKAP5 Human)
TagsEGFPExpressionMammalianMutationSilent mutations to confer shRNA resistance.PromoterCMVAvailable SinceOct. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
shBIRC5 # 2
Plasmid#42554DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
shBIRC5 # 1
Plasmid#42553DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#2/Cre
Plasmid#193245PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2a KI
Plasmid#131486PurposeEndogenous tagging of GluN2a: N-terminal (amino acid position: A25)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLP17_Lenti α-syn
Plasmid#239419PurposeLentiviral plasmid for SpCas9-based CRISPR KO of mouse α-synDepositorInsertmouse a-synuclein sgRNA (Snca Mouse)
UseLentiviralAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK4/GCN2_sgRNA
Plasmid#218528PurposesgRNA targeting human EIF2AK4/GCN2DepositorInsertEIF2AK4 (EIF2AK4 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5465_pHR_hU6-crScaffold_EF1a-PuroR-T2A-BFP
Plasmid#155307PurposeRfx Cas13d guide cloning lentiviral vector with constitutively expressed puromycin resistance 2A-tagged with tagBFPDepositorInsertRfx Cas13d CRISPR RNA puromycin resistance 2A-tagged BFP
UseLentiviralExpressionMammalianPromoterhU6, EF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
LCV2 IRF3 KO
Plasmid#217446PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human IRF3DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001148399)
Plasmid#76842Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only