We narrowed to 14,341 results for: cas9 genes
-
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only
-
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
LADL Anchor
Plasmid#127664PurposeEncodes the LADL Anchor (dCas9-CIBN fusion protein) and puromycin resistance both expressed from the EF1a promoterDepositorInsertdCas9-CIBN-2A-Puro
Tags3XFLAGExpressionMammalianMutationCas9 (D10A,H840A) mutantPromoterEF1aAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-OsPE2
Plasmid#141080PurposeGateway entry clone for CRISPR-Cas9(H840A) prime editingDepositorInsertzCas9(H840A)-OsM-MLV-RT
UseCRISPR; Gateway compatible zcas9(h840a)-osm-mlv-rtTags3x FLAG, NLS and NLSExpressionPlantAvailable SinceMay 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGPT2_5
Plasmid#163455Purposelentiviral vector expressing Cas9 and an sgRNA targeting GPT2DepositorInsertsgRNA 5 targeting GPT2 (GPT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGPT2_9
Plasmid#163456Purposelentiviral vector expressing Cas9 and an sgRNA targeting GPT2DepositorInsertsgRNA 9 targeting GPT2 (GPT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 1
Plasmid#70679PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 2
Plasmid#70660PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-73kb-DSF
Plasmid#227499Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 73kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-DSF
Plasmid#227482Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-30kb-DSF
Plasmid#227483Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-30kb-DSF
Plasmid#227484Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-30kb-DSF
Plasmid#227485Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-30kb-DSF
Plasmid#227486Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-35kb-DSF
Plasmid#227490Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-35kb-DSF
Plasmid#227491Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only