We narrowed to 8,876 results for: sgrna
-
Plasmid#230908PurposeDouble inducible expression of Cas12a+ with Gal4 and Flp.DepositorInsertCas12a+
UseCRISPRExpressionInsectAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-PLK4
Plasmid#227310PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8270 LentiCRISPR v2 hygro sgSIGIRR-3
Plasmid#193979PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8921
Plasmid#220903PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (BsaI site), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8932
Plasmid#220906PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PG-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide2 in pX458
Plasmid#211536PurposesgRNA-2 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide1 in pX458
Plasmid#211535PurposesgRNA-1 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TC9
Plasmid#202088Purposeentry vector for gateway recombination of TevCas9 and sgRNA into a destination cassette in pCitro-destDepositorInsertTevCas9 + sgRNA cassette
UseCRISPRAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHY55-mouse U6-sgLMNA
Plasmid#164045PurposeU6-driven sgRNA targeting LMNADepositorInsertLMNA targeting sgRNA
UseCRISPRPromotermouse U6Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF449_dpy-10_CDS_sg1
Plasmid#163866PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF328_sqt-3_3′UTR_sg2
Plasmid#163867PurposesgRNA targeting sqt-3 (3′UTR) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the 3'UTR of sqt-3
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF496_dpy-10_CDS_sg6
Plasmid#164267PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF495_dpy-10_CDS_sg6
Plasmid#164268PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJF439.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRExpressionWormPromoterU6 promoter from W05B2.8Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(NT:NT)
Plasmid#138260PurposeExpression of a non-targeting sgRNA to the left and right of iCas9 recognition site to be used as a control in Traffic Light reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJKW0457
Plasmid#107586PurposeAtU6-26 sgRNADepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6-26Available SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgX-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209060PurposeEntry cloning vector to insert an sgRNA of interest (using Esp3i digestion) into a vector that already contains sgRNAs against mouse Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertsgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianPromoterEf1-a and hU6Available SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9.EF1a-BFP.sgLMNA
Plasmid#98971PurposeCas9 Homologous Recombination Reporter. SpCas9 and a sgRNA targeting LMNA. TagBFP.DepositorInsertLMNA sgRNA and spCas9
ExpressionMammalianAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV270
Plasmid#226181PurposeExpresses Cas9 and gRNA targeting KU70 gene in K. phaffii.DepositorInserttRNA-sgRNA-tRNA
UseCRISPRExpressionBacterial and YeastPromoterTEF1p (Komagataella phaffii)Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aalb_743
Plasmid#176676PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029743) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1
Plasmid#108098PurposeLentiviral expression plasmid of sgRNA with GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRCherry2.1
Plasmid#108099PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Aaeg_774
Plasmid#176673PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017774) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1_Puro
Plasmid#125594PurposeLentiviral expression of sgRNA with GFP and puromycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
QPM-sgR (pTaU3)
Plasmid#140448PurposeFor sgRNA expression in monocotyledons protoplastsDepositorInsertTaU3-sgRNA
UseCRISPRExpressionPlantPromoterTaU3Available SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN479
Plasmid#86234PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse Rosa26 locusDepositorInsertspCas9-nickase and sgRNA against mouse rosa26 locus
UseMouse TargetingExpressionMammalianAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1201
Plasmid#92144PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse TIGRE acceptor locusDepositorInsertspCas9-nuclease and sgRNA against mouse TIGRE acceptor locus
ExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl
Plasmid#70007PurposeCRISPR/Cas9 vector for Yarrowia lipolytica, with AvrII site for sgRNA insertionDepositorInsertsCodon optimized Cas9 from S. pyogenes
sgRNA expression cassette
UseCRISPR and Synthetic BiologyExpressionYeastPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-CMV-NLS-dCas9-NLS
Plasmid#99908PurposeFor the expression of NLS-dCas9-NLSDepositorInsertNLS-dCas9-NLS
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEditA
Plasmid#207531PurposePlasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ ABE:SpnCas9, PEM7→non-specific sgRNA; SmR/SpRDepositorInsertPlasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ ABE:SpnCas9, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLib6.6
Plasmid#176652PurposeExpression of sgRNA under D. melanogaster U6-3 _(CR31539) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry
Plasmid#78534PurposeBackbone to clone single or paired sgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA)Available SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pV1382
Plasmid#111436PurposeS. cerevisiae and C. glabrata Solo CRISPR vector, marked with URA3 and NatRDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAT009
Plasmid#171635PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting B2M and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-B2M
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only