We narrowed to 841 results for: gcat
-
Plasmid#201402PurposeKnockdown of alpha-SMA. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertalpha-SMA
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZNF253.1.0-gDNA
Plasmid#132461PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF253 (ZNF253 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF780A.1.0-gDNA
Plasmid#132446PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF780A (ZNF780A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Gphn#2
Plasmid#240308PurposeDonor:smFP-V5 KO:Gphn#2DepositorInsertKO gRNAs for Gphn
UseAAVTagsExpressionMutationNAPromoterAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Gphn#1
Plasmid#240307PurposeDonor:smFP-V5 KO:Gphn#1DepositorInsertKO gRNAs for Gphn
UseAAVTagsExpressionMutationNAPromoterAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac4
Plasmid#126884PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Rac4
Plasmid#126896PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_2
Plasmid#126900PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ OBfold
Plasmid#126901PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ OBfold
Plasmid#126889PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgSnrk
Plasmid#177236PurposeExpresses neomycin (bU6), non-targeting (mU6) and Snrk (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgSnrk
UseLentiviralTagsExpressionMutationPromoterbU6/mU6/hU6Available sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorInsertRER2 gRNA (RER2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_2
Plasmid#166071PurposePlasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.DepositorInsertIntergenic region near CPR1
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GLK1
Plasmid#166090PurposePlasmid for constituive spCas9 and tet-inducible GLK1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertGLK1 (GLK1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PPE1
Plasmid#166083PurposePlasmid for constitutive spCas9 and tet-inducible PPE1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertPPE1 (PPE1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_TP73
Plasmid#214691PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-BCL2L1-A1
Plasmid#188692PurposesgRNADepositorInsertsgBCL2L1 (BCL2L1 Human)
UseCRISPR and LentiviralTagsExpressionMutationWTPromoterAvailable sinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Pdha1 Donor;3xV5 KO;Mff
Plasmid#240301PurposeKI:Pdha1 Donor:3xV5 KO:MFFDepositorInsertKI gRNA for Pdha1
UseAAVTagsExpressionMutationNAPromoterAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only