We narrowed to 5,091 results for: codon optimized
-
Plasmid#171922PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic helix-RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
UseTags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-hRNF216(511-784)
Plasmid#171923PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
UseTags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
RV-Cag-Dio-EYFP-P2A-cMaf
Plasmid#98174PurposeRetroviral vector encoding Cre-dependent expression of EYFP-P2A-MafDepositorInsertcMaf (codon optimzed) (Maf Mouse)
UseRetroviralTagsExpressionMutationCodon optimizedPromoterCAGAvailable sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTN6kwh
Plasmid#44724DepositorInsertspCMV-D2i promoter
htetR::NLS
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-HsAIDSc
Plasmid#60810Purposeto express human AID recoded for yeast codon usageDepositorInsertAID (AICDA Human)
UseTagsMycExpressionYeastMutationcodon optimized for yeastPromoterGAL1Available sinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35S:dCas9:Tnos (GB1191)
Plasmid#68223PurposeTranscriptional unit for human codon optimized with mutated (D10A, H840A) and inactivated catalytic domains Cas9 protein plant expression driven by the 35S promoterDepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removed; human codon optimis…Promoter35SAvailable sinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNHT7::UMSBP::sNluc2_ORF1
Plasmid#186765PurposeAn mRNA production vector encoding planarian codon-optimized sNluc2 with UMSBP 5' and 3' UTRs beginning at the endogenous gene's start codon.DepositorInsertNanoluciferase
UseTagsExpressionMutationPromoterT7Available sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-CH111-QES.c13.L544Y-754*
Plasmid#123264PurposeMammalian expression plasmid for Env from the CH111 HIV-1 isolate; C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (AD8) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-AD8-QES.i08.c04-754*
Plasmid#123258PurposeMammalian expression plasmid for Env from the AD8 HIV-1 isolate; C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (AD8) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q769-QES.i03.c04-754*
Plasmid#123228PurposeMammalian expression plasmid for Env from the Q769.d22 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q769.d22) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaL-QES.i01.c08-754*
Plasmid#123213PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-gp160-QES.i05.c06-754*
Plasmid#123275PurposeMammalian expression plasmid for Env from the BG505 HIV-1 isolate (containing SOSIP mutations); C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (BG505) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; SOSIP mutations; …PromoterCMVAvailable sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422-QES.c12-754*
Plasmid#123249PurposeMammalian expression plasmid for Env from the DU422 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (DU422) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q842-QES.i04.c05-754*
Plasmid#123232PurposeMammalian expression plasmid for Env from the Q842.d12 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q842.d12) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-191084-QES.i06.c07-754*
Plasmid#123238PurposeMammalian expression plasmid for Env from the 191084 B7-19 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (191084 B7-19) Env
UseTagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-V5-hTEV
Plasmid#65800Purposeexpresses human codon-optimised TEV proteaseDepositorInsertV5-human TEV
UseTagsV5ExpressionMammalianMutationcodon-optimised to express in mammalian cellsPromoterCMVAvailable sinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pSR21
Plasmid#69156Purposeread-outlox2272 mCherry to tagBFP switch for integration on ttTi14024, Chr XDepositorInsertsmCherry
TagBFP
UseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0Promoterrps-27Available sinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUB_SM-RLuc0---MS2
Plasmid#210572PurposeExpresses SM(FLAG)-nonoptimal Renilla with 3'UTR MS2 hairpinsDepositorInsertSpaghetti monster (FLAG)-nonoptimal Renilla luciferase
UseLentiviral and LuciferaseTagsSpaghetti monster (FLAG)ExpressionMammalianMutationPromoterUBC humanAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SM-FLuc0-malat1
Plasmid#210580PurposeExpresses SM(FLAG)-nonoptimal Firefly - 3'UTR malat1 triple helixDepositorInsertSpaghetti monster (FLAG)-nonoptimal FLuc - 3'UTR malat1 triple helix
UseLuciferaseTagsSpaghetti monster (FLAG)ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
LC8-like
Plasmid#133115PurposeHuman LC8-like protein, codon optimised for Sf9 expression.DepositorInsertLC8-like (LOC392067 Human)
UseTagsExpressionInsectMutationCodon optimised for Sf9 expressionPromoterAvailable sinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
1456_pDEST_miniTol2_R4-R2_Cryst-eGFP
Plasmid#171795PurposepDEST miniTol2-clone for R4-R2 3-component gateway assembly (p5E + pME). Include a eGFP selection marker (Crystallin promoter Lens/Eyes)DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSR02
Plasmid#69149PurposeRead-out loxP mCherry to GFP switch for integration on CxTi10816, Mos chr IVDepositorInsertsmCherry
eGFP
UseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0Promoterrps-27Available sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEND-351_Cacnes_dCas9_CRISPRi
Plasmid#225617PurposeCutibacterium acnes replicative plasmid with dCas9 for CRISPRi. pBRESP36A-based vector optimized for reduced size and modular assembly, harbouring a medium-copy pBR322 E. coli ori (no ROP)DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesPromoterAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
enIscB-T5E
Plasmid#205411PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fused with T5E at C-terminal driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_XTEN_T5E_npNLS_pU6__RNA*_pCMV_mCherry
UseTagsExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
UseTagsExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable sinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only