We narrowed to 4,533 results for: Gaa
-
Plasmid#135760PurposeEncodes gRNA for 3' target of human ONECUT2DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pBzCas13b-gRNA-NT
Plasmid#164861PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-NT
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-shCntrl
Plasmid#69040PurposeLentiviral expression of control shRNADepositorInsertcontrol shRNA
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-hSC
Plasmid#46896Purposeexpression of scrambled shRNADepositorInsertscrambled
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pC016-gPsp-Control
Plasmid#233611PurposeExpression of guide RNA for PspCas13bDepositorInsertControl gRNA
UseCRISPRAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pESR1.1.0-gDNA
Plasmid#112433PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ESR1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-slr0230-PL22-sgRNANT1-KmR
Plasmid#73224PurposeContains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coliDepositorInsertPL22-sgRNA NT1
ExpressionBacterialPromoterPL22Available SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKHH030
Plasmid#89358PurposehU6 sgRNA cloning vector for CDKO systemDepositorInsertGFP, Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g1 + Cas9
Plasmid#153011PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBSU6-shScr/CMV-eGFP
Plasmid#89912PurposeExpress shRNA Scrambled controlDepositorInsertshRNA Scrambled
TagseGFP under separate promoterExpressionMammalianAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-FOXM1-shRNA-#3
Plasmid#89500PurposeLentiviral vector with dox inducible expression of shRNA targeting human FOXM1.DepositorInsertFOXM1 (FOXM1 Human)
UseLentiviral and RNAi; Doxycycline inducibleExpressionMammalianPromoterH1/TOAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
GOSR2(G144W)-mCherry
Plasmid#209887PurposeExpresses human GOSR2 (GS27) G144W-mutant fused to mChery in mammalian cellsDepositorInsertGOSR2 (GOSR2 Human)
TagsmCherryExpressionMammalianMutationChanged glycine 144 to tryptophan; this mutation …PromoterCMVAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 sgATG7
Plasmid#211534PurposeDeletes ATG7DepositorInsertsgATG7
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-Tet2
Plasmid#85743PurposeshRNA against mouse Tet2DepositorInsertshRNA Tet2
UseAAVTagsEYFPAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NM23-H1
Plasmid#10956DepositorInsertNM23 (NME1 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_T2A-Gal4vp16_synCoTC_4xnrUAS-mKate2
Plasmid#199482PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_2_T2A-Gal4vp16_synCoTC_4xnrUAS-mKate2
Plasmid#199483PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_T2A-Gal4vp16_synCoTC_4xnrUAS-mKate2
Plasmid#199481PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-hGFAP-mCherry-shPtbp1
Plasmid#178589PurposeExpression of mCherry and a shRNA against Ptbp1 under the human GFAP promoterDepositorInsertmiRE-Ptbp1
UseAAVExpressionMammalianAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-TUBB
Plasmid#66942PurposeCRISPaint target selector TUBBDepositorInsertgRNA TUBB
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#1
Plasmid#44127DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g2
Plasmid#153012PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing mCherryDepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only