We narrowed to 16,742 results for: grna
-
Plasmid#184441PurposesgRNA with MS2 aptamer, TagRFP657 as selection markerDepositorInsertsgRNA-MS2x2, TagRFP657
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
BCKDK gRNA (BRDN0001147783)
Plasmid#75503Purpose3rd generation lentiviral gRNA plasmid targeting human BCKDKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
7i sgRNA for 4-μHOM reporter
Plasmid#113626PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter 8 nts. upstream from the microhomologyDepositorInsert7i sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU3b/LacZ
Plasmid#66199Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterAtU3bAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
gRNA-ura-HYB
Plasmid#64330Purposeura3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of ura3 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
retro-gRNA-mRFP1
Plasmid#112914PurposeRetrovirus expressing mRFP1 with BBSI cloning sites for sgRNADepositorInsertmRFP1
UseRetroviralPromoterEF1aAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CRISPRi-sgRNA
Plasmid#221135PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with dCas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
BCKDK gRNA (BRDN0001149253)
Plasmid#75505Purpose3rd generation lentiviral gRNA plasmid targeting human BCKDKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A10.2 gRNA
Plasmid#90549Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A10.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-egfp-U3-Osp.gRNA
Plasmid#166034PurposeEmpty backbone for expression of gRNA-expressing integration deficient lentiviral particles.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK2 gRNA (BRDN0001148577)
Plasmid#75638Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PU6::unc-119_sgRNA
Plasmid#46169Purposeunc-119 targeting sgRNADepositorInsertunc-119 targeting sgRNA (unc-119 Synthetic)
UseCRISPRPromoterC. elegans U6 snRNA pol III promoterAvailable SinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
EPHA7 gRNA (BRDN0001145253)
Plasmid#77351Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PINK1 gRNA (BRDN0001145357)
Plasmid#78036Purpose3rd generation lentiviral gRNA plasmid targeting human PINK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK3 gRNA (BRDN0001145848)
Plasmid#77166Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV/eGFP-U6-sgRNA
Plasmid#170544PurposeA lentiviral backbone for homology directed insertion of eGFP. Containing only eGFP, flanked by restriction sites for insertion of homology arms and a sgRNA casstte to clone in sgRNA for HDRDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001148399)
Plasmid#76842Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-A
Plasmid#177784PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only