We narrowed to 8,708 results for: sgRNA
-
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVTagsExpressionMutationPromotercTnTAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…TagsExpressionMammalianMutationPromoterCAGCAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-DNM1L -GFP
Plasmid#221845PurposeTol2 transposon expressing sgRNA targeting chick DNM1L from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
DNM1L sgRNA-gTGTTTTCCGACCATCCTCTG
UseCRISPR; Tol2 transposon optimised for chick expre…TagsExpressionMammalianMutationPromoterCAGC and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-MFN1-GFP
Plasmid#221846PurposeTol2 transposon expressing sgRNA targeting chick MFN1 from chick U6.3 promoter expresses GFP reporter from GAGC promoteDepositorInsertsEGFP
MFN1 sgRNA-GAGAAGAAGAGCGTCAAGGT
UseCRISPR; Tol2 transposon optimised for chick expre…TagsExpressionMammalianMutationPromoterCAGC and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorInsertsgRNA targeting LIG4 exon 3 (LIG4 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-recipient_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211651PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-recipient_U6-sgRNA-EF1a-mCherry2
Plasmid#211647PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorInsertsgATM (Atm Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMRE11
Plasmid#208384PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MRE11 gene.DepositorInsertsgMRE11 (Mre11a Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#3
Plasmid#208389PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#3 gene.DepositorInsertsgZBP1 (Zbp1 Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorInsertsgMLKL (Mlkl Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 ACTB sgRNA
Plasmid#206270PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes hU6 hACTB sgRNADepositorInsertACTB sgRNA
UseCRISPR; Multimate/gateway entr 2TagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRTagsExpressionMammalianMutationPromotercmb and u6Available sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorArticleInsertAsCpf1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only