We narrowed to 4,733 results for: Gca
-
Plasmid#127112DepositorInsertgRNA G3BP2 (G3BP2 Human)
UseCRISPRAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M7NS_AmpR
Plasmid#119157PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with seven mismatches in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with seven mismatches in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pENTR-PpU6P-sgRNA-R4R3
Plasmid#113739PurposeGateway entry vector containing attR4 and attR3 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR and Gateway CloningPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L5L4
Plasmid#113741PurposeGateway entry vector containing attL5 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR and Gateway CloningPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1R5
Plasmid#113737PurposeGateway entry vector containing attL1 and attR5 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR and Gateway CloningPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
px330-TSC1
Plasmid#254275PurposeKnockout TSC1DepositorInsertTsc1 gRNA (Tsc1 Mouse)
UseCRISPRAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRCA360 - pBA904 Puro-T2A-GFP
Plasmid#238164PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseLentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDSP31
Plasmid#199373PurposeEncodes dual cistronic nuclear localized GCaMP6f and mScarlet-I optimized for C. elegans expressionDepositorInsertNLS::GCaMP6f::egl-13NLS::SL2::NLS::mScarlet-I::egl-13NLS
ExpressionBacterialMutationno mutations, except added subcellular localizati…Available SinceApril 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBbdCas9S_P0526-sgRNAmreB
Plasmid#149654Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4_NANOG
Plasmid#64156PurposePhotoactivatable transcription system. Lentiviral expression of NANOG sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
shTBX5 # 1
Plasmid#42549DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO
Plasmid#172225PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the centromeric human SOX17 CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pAGM_Puro_shRNA n.1_mTet3
Plasmid#79624PurposeExpression of shRNA for mouse Tet3DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB-XPRESSO-CaViar
Plasmid#237299PurposeSleeping Beauty XPRESSO vector for CaViar expressionDepositorInsertCaViar
TagsV5ExpressionMammalianPromoterCAGAvailable SinceAug. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Control-Control-LRG-GFP
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgNCKAP1-2
Plasmid#210134Purposeknock out NCKAP1 in mammalian cellsDepositorInsertNck-associated protein 1 (NCKAP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHW581
Plasmid#198818PurposeIn vivo calcium indicator. Presence of calcium (Ca2+) increases reporter signal intensity. Based on GCaMP7, improved SNR, fast kineticsDepositorInsert15xUAS::GCaMP7f-SL2-mKate2::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_human_ADAR2_ccA
Plasmid#158114Purposedeletion hADAR2DepositorInsertADAR2 (ADARB1 Human)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKdm6a#2/Cre
Plasmid#173638PurposeExpresses a Kdm6a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kdm6a (Kdm6a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKdm6a#1/Cre
Plasmid#173637PurposeExpresses a Kdm6a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kdm6a (Kdm6a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCB320-sgNC.SPA
Plasmid#169834PurposeExpresses a negative control sgRNADepositorInsertsafe harbor sgRNA
UseCRISPR, Lentiviral, and Mouse TargetingExpressionMammalianPromotermU6Available SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTX1-SMN1-exon7-ESE1
Plasmid#126041PurposeIn-vitro-transcription of SMN1-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN1 exon7 ESE1
Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -