We narrowed to 25,582 results for: grn
-
Plasmid#119144PurposeEncodes non-targeting sgRNADepositorInsertnon-targeting sgRNA
UseCrisprAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tBFP
Plasmid#169940PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tBFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_LacZ_sgRNA_2
Plasmid#155093Purposelentiviral plasmid expressing Cas9 and gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_Dual_epegRNA_tevopreQ1
Plasmid#187454PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_scrambled_gRNA_2
Plasmid#196628PurposeScrambled control 2 for STING knock-out in murine cells.DepositorInsertmSTING scrambled gRNA 2
UseCRISPR and LentiviralMutationWTAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIA1
Plasmid#106097PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1DepositorInsertgRNA TIA1
UseCRISPRAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
Nme2sgRNA_pLKO
Plasmid#119926PurposeNme2Cas9 U6-driven sgRNA cassetteDepositorInsertNmeCas9 sgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_sgRNA
Plasmid#100554PurposeExpresses AAVS1 sgRNA. Target sequence: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
p104_gRNA_Sp_CD3e
Plasmid#213780PurposeExpresses CRISPRi gRNA for CD3e promoter and GFP. gRNA driven by mU6.DepositorInsertSp gRNA
UseCRISPR and LentiviralAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_AT
Plasmid#196243PurposeBackbone plasmid for cloning sgRNADepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterJ23119Available SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available SinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR_AtU6p_BsaI_gRNA
Plasmid#225987PurposeTo make Gateway entry clone of CRISPR guide RNA under AtU6pDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
STAGR_gRNAScaffold_hH1
Plasmid#102841PurposeCan be used as PCR template for a STAgR reactionDepositorInsertSTAgR Insert gRNAScaffold_hH1
UsePcr template for stagr insertsPromoterhH1Available SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
STAGR_gRNAScaffold_h7SK
Plasmid#102842PurposeCan be used as PCR template for a STAgR reactionDepositorInsertgRNAScaffold_h7SKpromoter
UseAs pcr templatePromoterh7SKAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB_gRNA_S.pyogenes_scaffold_BB
Plasmid#226429PurposePiggyBac transposon vector backbone for cloning of sgRNA compatible with S.pyogenes dCas9 enzyme. BbsI Golden Gate site upstream of the scaffold for protospacer insertion. Puromycin selection marker.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA_MS2_neo
Plasmid#118650PurposeTo clone sgRNA for activation dCas9DepositorTypeEmpty backboneUseLentiviralPromoterU6Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
EC2_1_dCas9_sgRNA
Plasmid#163710PurposeYeast low copy plasmid with dCas9 and sgRNA expression cassetteDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbPDS
Plasmid#231147PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbPDSDepositorInsertmobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only