We narrowed to 8,392 results for: crispr grnas
-
Plasmid#132548Purposeexpresses gRNA for SLBP-based CIRTSDepositorInsertgRNA SLBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149423)
Plasmid#80255Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148500)
Plasmid#80260Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.CYRANO
Plasmid#128755PurposeExpresses CYRANO gRNA for CRISPRiDepositorAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
U6-CjCas9-MS2gRNA-Backbone
Plasmid#210711PurposeThis plasmid express MS2 loop containing Cj Cas9 gRNADepositorInsertMS2 loop containing Cj Cas9 gRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
eGFP L138 gRNA
Plasmid#119133PurposegRNA that guides Cas9 and APOBEC complexes to L138 in eGFP.DepositorInserteGFP L138 gRNA
UseCRISPRMutationNonePromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-UGCG-KO
Plasmid#80010PurposegRNA to knock out expression of UGCG gene. The product of this gene catalyzes the first step in synthesis of glycosphingolipids.DepositorInsertUGCG (UGCG Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRainbow-DONOR1
Plasmid#75398PurposeCRISPRainbow-DONOR1DepositorInsertCm(R)-CcdB
UseCRISPRTagsnoPromoterBacteriaAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro Non-targeting sgRNA 1
Plasmid#109002PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertNon-targeting sgRNA #1
UseLentiviralExpressionMammalianPromotermU6 promoterAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_2
Plasmid#104049PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_1
Plasmid#104048PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_1
Plasmid#104050PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_1
Plasmid#86346PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJA14
Plasmid#59929PurposegRNA for cleavage at rde-1(H974) locus in C elegansDepositorInsertrde-1(H974) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9(1.1)-2×sgRNA (IFT88, donor)
Plasmid#80769PurposeExpresses eSpCas9(1.1) and two sgRNAs. The first gRNA targets human IFT88 and the second gRNA targets a pDonor-tBFP-NLS-Neo (Universal).DepositorAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only