We narrowed to 1,730 results for: Tyr
-
Plasmid#76354Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001144879)
Plasmid#76352Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001148436)
Plasmid#76353Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CmCitrine Lck w/ NosUTRs
Plasmid#66785Purposeexpression of fluorescent membranes in sea urchin primordial germ cellsDepositorInsertLck (LCK Human)
UseSea urchin, zebrafish, xenopusTags3' UTR from sea urchin Nanos, 5' UTR fr…MutationTandem repeat of LCK the N-terminal membrane targ…PromoterT7Available SinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
EPHB3_HUMAN_D0
Plasmid#79732PurposeThis plasmid encodes the kinase domain of EPHB3. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3_HUMAN_D0
Plasmid#79708PurposeThis plasmid encodes the kinase domain of EPHA3. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB2_HUMAN_D0
Plasmid#79697PurposeThis plasmid encodes the kinase domain of EPHB2. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Af1521(K35E/Y145R)-myc
Plasmid#196237PurposeAf1521(K35E/Y145R) macrodomain with a myc tag fused to the C terminus & a hygromycin resistance cassetteDepositorInsertAf1521(K35E/Y145R) encoding a C-terminal myc tag
UseLentiviralTagsmyc tagExpressionMammalianMutationamino acid 35 lysine is replaced with glutamic ac…PromoterEF1AAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-LAMP1-Y414A
Plasmid#222319PurposeSynchronize the trafficking of LAMP1-Y414A from the ER.DepositorInsertStreptavidin-KDEL and LAMP1-Y414A fused to SBP-EGFP (LAMP1 Human)
ExpressionMammalianMutationTyr414 to AlaPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT7
Plasmid#127515PurposePlasmid encodes H. sapiens codon optimized Integrase 7.DepositorInsertIntegrase 7 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianMutationIn 2126 position an G mutated for an T changed th…Available SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-FX
Plasmid#111272Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20-amino-acid linker (GGS)3GS(GGS)3, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20aa linker (Syk Mouse)
ExpressionBacterialMutationinterdomain A (Phe 119 to His 162) substituted by…PromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD63YA-SBP-EGFP
Plasmid#222327PurposeSynchronize the trafficking of CD63YA from the ER.DepositorInsertStreptavidin-KDEL and CD63-Y235A fused to SBP-EGFP (CD63 Human)
ExpressionMammalianMutationTyr235 to AlaPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-Y195F
Plasmid#203573PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Tyrosine 195 to Phenylalanine for partial…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835Y-V5/HIS
Plasmid#236007Purposeexpression of the D835Y kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid Leukemia and Acute Lymphoblastic LeukemiaDepositorInserthuman FLT3-D835Y receptor tyrosine kinase, full length (FLT3 Human)
TagsV5/HisExpressionMammalianMutationD835Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMal-Abl-PRM 5R
Plasmid#112088PurposeBacterial expression plasmid containing His and MBP tags for 5 PRM motif repeats of Human Abl.DepositorInsertPRM-5R (ABL1 Human)
TagsHis-6 and MBPExpressionBacterialMutationconstruct contains only the PRM motif of Abl1PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
MERTK gRNA (BRDN0001145505)
Plasmid#76444Purpose3rd generation lentiviral gRNA plasmid targeting human MERTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ERBB3-v2
Plasmid#154894PurposeExpresses ERBB3 (a.k.a HER3) fused to Venus fragment 2 (v2) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only