We narrowed to 11,250 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#191528PurposeVector for tandem expression of SLBP 3'UTR G1 sgRNA in combination with ATP1A1 G3 sgRNA from two independent U6 promoters to facilitate SLBP endogenous tagging by marker free coselection using ouabainDepositorInsertSLBP 3'UTR G1 sgRNA + ATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJK434
Plasmid#155378PurposePphlF_A4NT, 1x cascade + [dCas9 + PA4-mVenus]. (Integration of 429; pOSIP)DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A4NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK430
Plasmid#155377PurposePphlF_A2NT in dCRv1, 2x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A2NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Cas9-NRCH
Plasmid#136926PurposeExpresses Cas9-NRCH in mammalian cellsDepositorInsertCas9-NRCH
UseCRISPRExpressionMammalianMutationsee manuscriptPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-VPR-H2B-mCherry (CRISPRa)
Plasmid#175572PurposeInactivated Cas9 (dCas9) fusion to VPR for the purpose of targeted activationDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalPromoterEF1aAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDHt/sk-PE
Plasmid#92126PurposeExpression of codon-optimized Cas9-eGFP fusion protein with Ppdc promoter in Trichoderma reeseiDepositorInsertCas9-eGFP
UseCRISPR; Trichoderma reesei expressionTagsEGFPPromoterPpdcAvailable SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-AID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9-VRER_2A_GFP
Plasmid#75475PurposeCas9 VRER variant that detects NGCG PAM, combined with 2A_GFP for expression controlDepositorInsertCas9-VRER
UseCRISPRTags2A_GFPExpressionMammalianMutationD1135V, G1218R, R1335E, T1337RPromoterCAGAvailable SinceMay 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Human CRISPR-Cas9 Deletion Library - Drug targets, kinases, phosphatases
Pooled Library#101927PurposeBassik lab Human CRISPR-Cas9 Deletion Library - Drug targets, kinases, phosphatases. Coexpresses mCherry.DepositorExpressionMammalianUseCRISPRAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9 (without sgRNA)
Plasmid#92354PurposeExpression plasmid for human codon-optimized high-fidelity eSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes enhanced Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, K1003A, R1060APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCas9-T2A-BFP
Plasmid#78547PurposeCas9 protein with BFPDepositorInsertT2A-BFP
UseLentiviralExpressionMammalianPromoterIn frame with Cas9Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-Tet1-CD
Plasmid#83340PurposeTo introduce dCas9-fused Tet1-CD and sgRNA2.0 systemDepositorInsertdCas9-Tet1-CD and sgRNA scaffold with 2xMS2 binding sites
UseCRISPRExpressionMammalianMutationD10A, H840APromoterU6, CBHAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-KRAB-MECP2-H2B-GFP (CRISPRi)
Plasmid#175573PurposeInactivated Cas9 (dCas9) fusion to KRAB and MeCP2 for the purpose of targeted repressionDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-dCas9-5xPlat2AflD
Plasmid#82560PurposeExpression vector for Cas9 peptide array (linker length: 22aa).DepositorInsertdCas9-5xPlat2AflD
ExpressionMammalianAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-EF1a-dCas9-HA-BFP-KRAB-NLS
Plasmid#102244PurposeLentiviral expression of dCas9-HA-BFP-KRAB-NLS for CRISPRi driven by a hEF1alpha promoterDepositorInsertdCas9-HA-BFP-KRAB-NLS
UseCRISPR and LentiviralTagsHA-TagBFP-KRAB-NLSExpressionMammalianPromoterEF1aAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAC154-dual-dCas9VP160-sgExpression
Plasmid#48240PurposeDual expression construct expressing both dCas9VP160 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA-Tag, HA-tag, and VP160ExpressionMammalianMutationD10A H840AAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-SMASh-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187949PurposeSMASh degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSMASh-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only