167,910 results
-
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChRmine-oScarlet (AAV8)
Viral Prep#137160-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Coff/Fon-ChRmine-oScarlet (#137160). In addition to the viral particles, you will also receive purified pAAV-nEF-Coff/Fon-ChRmine-oScarlet plasmid DNA. nEF-driven expression of ChRmine-oScarlet in the presence of Flp (inhibited in the presence of Cre). These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsoScarlet (Flp-dependent)Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
loxP-Puro-loxP-3xV5-SNAP-Rab11 HR
Plasmid#229677PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with SNAP tag and a 3x V5 epitope tag. Contains a puromycin resistance cassette for selection of edited cells.DepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRL-SV40P
Plasmid#27163PurposeRenilla SV40 promoter (no enhancer) reporter gene for normalization of luciferase experimentsDepositorInsertSV40 promoter
UseLuciferaseTagsRenilla LuciferaseExpressionMammalianAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pvimentin-emiRFP703
Plasmid#136566PurposeVimentin labeling with near-infrared fluorescent protein emiRFP703 (enhanced miRFP703)DepositorInsertvimentin-emiRFP703
TagsemiRFP703ExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2_mTagBFP2
Plasmid#113725PurposeExpresses the fluorescent protein mTagBFP2 in a lentiviral backboneDepositorInsertmTagBFP2
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Keasling-2337
Plasmid#100168PurposeUsed to improve production from engineered biosynthetic pathways include optimizing codon usage, enhancing production of rate-limiting enzymes, and eliminating the accumulation of toxic intermediates or byproducts to improve cell growthDepositorInsertlacIq-Ptrc-ADS
ExpressionBacterialPromotertrcAvailable SinceSept. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Cancer and Apoptosis (m2), top 5 sgRNAs/gene
Pooled Library#83999PurposeMouse CRISPRa Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET Flag TEV LIC cloning vector (1L)
Plasmid#29662DepositorTypeEmpty backboneTagsFlag and TEV cleavage siteExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMRE-Tn7-132
Plasmid#118550PurposeminiTn7 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertsGFP2
UseMinitn7 delivery vectorExpressionBacterialAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMRE-Tn7-135
Plasmid#118553PurposeminiTn7 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertmScarlet-I
UseMinitn7 delivery vectorExpressionBacterialAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC15A4
Plasmid#131910PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC15A4 (SLC15A4 Human)
ExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF2895
Plasmid#144355PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.LSL.tdTomato
Plasmid#100048PurposeAAV mediated Cre-dependent expression of tdtomato (Lox-Stop-Lox)DepositorInserttdtomato
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3.1-OPNa
Plasmid#107980Purposeexpression of full-length OPNDepositorInsertfull-length osteopontin (SPP1 Human)
ExpressionMammalianAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSG5-His-SUMO1
Plasmid#17271DepositorAvailable SinceMarch 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHR-Flag-APH4-Fibcon-icam
Plasmid#233077PurposeExpresses synCAM-APH4-Fibcon-icamDepositorInsertAPH4-FIBCON-ICAM
UseLentiviralExpressionMammalianAvailable SinceMay 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM4D(Gi)-mCherry
Plasmid#44362PurposeDouble floxed Gi-coupled hM4D DREADD fused with mCherry under the control of human synapsin promoter.DepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserthM4D(Gi)-mCherry
UseAAV; Adeno associated viral vectorTagsmCherryPromoterhuman Synapsin 1Available SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-TSF-TBK1
Plasmid#216709PurposeMammalian expression of TBK1DepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SEP-Glur2 (MCA10)
Plasmid#64941Purposemammalian expression of rat GluR2DepositorAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-jYCaMP1s (AAV1)
Viral Prep#135424-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-jYCaMP1s (#135424). In addition to the viral particles, you will also receive purified pAAV-syn-jYCaMP1s plasmid DNA. Synapsin-driven expression of calcium sensor YCaMP1s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-MAFB-IRF8-CEBPA
Plasmid#190720PurposeFor microglia differentiation from iPSCDepositorInsertMAFB-IRF8-CEBPA
ExpressionMammalianAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-MP2
Plasmid#36097Purpose3rd generation lentiviral plasmidDepositorTypeEmpty backboneUseLentiviralAvailable SinceJune 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
CDK1as_T2A_puromycin
Plasmid#118595PurposeOne of three plasmids required to create CDK1as human cells by single transfection (One shot system). CDK1as cDNA and puromycin resistance cassette flanked by Sleeping Beauty transposon.DepositorInsertCDK1
ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC43
Plasmid#66565PurposesgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 2XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar3
Plasmid#232740PurposeExpresses NADPH/NADP+ biosensor NAPstar3 in S. cerevisiae.DepositorInsertNAPstar3
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only