We narrowed to 2,906 results for: aen
-
Plasmid#11578PurposeCre-regulated lentiviral shRNA vector. Cre addition causes EGFP to be recombined out of the construct, activating shRNA expression.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only
-
pDD317 (Pmyo-2::GFP + SEC)
Plasmid#73344PurposeSEC vector carry Pmyo-2::GFP and ccdB sites for cloning homology armsDepositorInsertPmyo-2::GFP + SEC
UseCRISPR and Cre/LoxTagsGFPExpressionWormPromotermyo-2Available SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSEM229 - [Pmlc-1 | mNeonGreen | cbr-tbb-2 UTR]
Plasmid#159896PurposeFluorescent co-injection marker to identify extrachromosomal arrays in C. elegansDepositorInsertPmlc-1 | mNeonGreen | cbr-tbb-2 UTR
ExpressionWormAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM228 - [Pmlc-1 | mNeonGreen(2x NLS) | cbr-tbb-2 UTR]
Plasmid#159895PurposeFluorescent co-injection marker to identify extrachromosomal arrays in C. elegansDepositorInsertPmlc-1 | mNeonGreen(2x NLS) | cbr-tbb-2 UTR
ExpressionWormAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
TurboID-mNeongreen-3xFLAG fusion pos3
Plasmid#172864PurposeC. elegans codon-optimized gateway entry vector expressing TurboID-mNeongreen fusion proteinDepositorInsertTurboID
UseUnspecifiedTagsFLAG, mNeongreen, and mycAvailable SinceOct. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wElectra2
Plasmid#184933PurposeCodon optimized blue fluorescent protein Electra2 in C.elegans expresison plasmidDepositorInsertElectra2
ExpressionWormPromotertag-168Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSico PGK GFP
Plasmid#12093PurposeCre-regulated lentiviral shRNA vector. Cre addition causes the EGFP gene to be recombined out of the construct, activating shRNA expression.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMDJ39 - Peft-3 Cre (PATCs)
Plasmid#191381PurposeHigh efficiency CRE recombinase expression in C. elegansDepositorInsertPeft-3 Cre tbb-2 UTR
ExpressionWormPromoterPeft-3Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2259 - Intron GG2 - 900 bp
Plasmid#159881PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG2 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2215 - Intron GG3 - 900 bp
Plasmid#159882PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG3 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2214 - Intron GG1 - 900 bp
Plasmid#159880PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDD268
Plasmid#132523PurposemNG^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertmNG-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized mNGExpressionWormAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDD282
Plasmid#66823PurposeGFP^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertGFP-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized GFPExpressionWormAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHW522 (Prab-3::cGAL-C::let-858 3'UTR)
Plasmid#107130PurposecGAL-C driver under the control of C. elegans rab-3 promoterDepositorInsertNLS::gp41-1-C-intein::cGAL(AD)
ExpressionWormPromoterC. elegans rab-3 promoterAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pflp-18::NGL-1::spGFP11
Plasmid#65828PurposeFor trans-synaptic labelingDepositorAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-TaGu-WT-3xF-ORF
Plasmid#238487PurposeFor production of C-term flag-tagged TaGu R2 ORF mRNA for mRNA transfection in PRINTDepositorInsertR2 retroelement mRNA
UseIvt templateTags3x-FlagAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSicoR
Plasmid#11579PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF shRNA expression.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 3, 2006AvailabilityAcademic Institutions and Nonprofits only