167,910 results
-
Plasmid#226336PurposePhotoswitchable fluorescent protein for correlative light-electron microscopy; mEosEM-E for prokaryotic expressionDepositorInsertmEosEM-E
TagsHisExpressionBacterialPromoterT7Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-msMMS22L
Plasmid#221014Purposemammalian expression vector of eGFP tagged mouse MMS22LDepositorInsertMMS22L (Mms22l Mouse)
TagseGFPExpressionMammalianMutationnaturally siResistant to siMMS22L (human) aagacuu…PromoterCMVAvailable SinceSept. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAVS1 EGFP-LC3B HRD
Plasmid#207551PurposeHomologous recombination donor to integrate and expression cassette for eGFP-LC3B in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-LC3B
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-GABARAPL1 HRD
Plasmid#207552PurposeHomologous recombination donor to integrate and expression cassette for EGFP-GABRAPL1 in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-GABARAPL1
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_MmaPylT_EF1_NES-MmaPylRS WT
Plasmid#174901Purposeexpression of Mma PylRS with nuclear export sequence for amber suppression in mammalian cells; transient or piggy bac mediated integrationDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJUMP24_T24_pRham-ilvA-relE
Plasmid#201531PurposeExpressing synthetic overlapping gene, ilvA-relE. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorInsertilvA-relE
UseSynthetic BiologyPromoterPrhaBAD (rhamnose)Available SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SEMA3E-Fc(DAPA)-AviTag-6xHis
Plasmid#156970PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.DepositorInsertSEMA3E (SEMA3E Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PL05006A1C09-pc2
Plasmid#26538DepositorInsertprohormone convertase 2
Available SinceNov. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
Flag-SRm160
Plasmid#11305DepositorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-parkin WT
Plasmid#45875DepositorAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMS2M-PH-gagpol-D64V
Plasmid#166031PurposeExpression of bacteriophage-derived MS2 coat protein fused HIV-1 Lentiviral Gag-Pol at N terminal with a HIV-1 protease cleavage signal between MS2 and Gag-Pol.DepositorInsertMS2-Gag-Pol
UseLentiviralMutationD64V mutation within the integrase within PolAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBA559
Plasmid#186235PurposepTet-LbuCas13a crRNA entry vectorDepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-splitTVA-EGFP-tTA (AAV1)
Viral Prep#100798-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-FLEX-splitTVA-EGFP-tTA (#100798). In addition to the viral particles, you will also receive purified pAAV-syn-FLEX-splitTVA-EGFP-tTA plasmid DNA. Helper virus for monosynaptic tracing with rabies virus; to be coinjected with pAAV-TREtight-mTagBFP2-B19G (Addgene#100799). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K6
Plasmid#22900DepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK6 only, all other lysines mutated to argininesAvailable SinceJan. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CMVs.Pl.Cre.rBG (AAV9)
Viral Prep#105537-AAV9PurposeReady-to-use AAV9 particles produced from pENN.AAV.CMVs.Pl.Cre.rBG (#105537). In addition to the viral particles, you will also receive purified pENN.AAV.CMVs.Pl.Cre.rBG plasmid DNA. CMV-driven Cre. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Talin-TS
Plasmid#83376PurposeFRET probe for measuring tension on Talin moleculeDepositorInsertTalin1 (Tln1 Mouse)
UseRetroviralTagsEGFP-F40-tagRFP (tension sensor module)ExpressionMammalianMutationTension sensor module is inserted between V447 an…PromoterCMVAvailable SinceOct. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GFP(1-10)
Plasmid#70219PurposeExpresses GFP(1-10) in mammalian cellsDepositorHas ServiceCloning Grade DNAInsertGFP(1-10)
ExpressionMammalianAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
mito NAD+ biosensor
Plasmid#186791PurposeNAD+ biosensor comprised of a circularly permuted Venus fluorescent protein (cpVenus), a bipartite NAD+-binding domain modeled from bacterial DNA ligase, and a localization tag totarget mitochondriaDepositorInsertmito NAD+ biosensor
UseLentiviralExpressionMammalianAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
GZnP3 in pcDNA3.1+
Plasmid#161738PurposeCytosolic fluorescent reporter for Zn²⁺ (Kd = 1.3 nM, ex/em = 488 nm/515 nm)DepositorInsertGZnP3
ExpressionMammalianPromoterCMVAvailable SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE GFP
Plasmid#10668PurposeEmpty backbone for retroviral gene expression. Select recipient cells using GFP.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceOct. 11, 2005AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-EcoEnv
Plasmid#15802DepositorInsertMLV env (ecotropic)
ExpressionMammalianAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
EGFP-alphasynuclein-A53T
Plasmid#40823DepositorInsertSNCA (SNCA Human)
TagsEGFPExpressionMammalianMutationA53T (aggregates more rapidly than the wild-type …PromoterCMVAvailable SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-EGFP (AAV9)
Viral Prep#50469-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CaMKIIa-EGFP (#50469). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-EGFP plasmid DNA. CamKIIa-driven EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsEGFPAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2/7
Plasmid#112863PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap7
UseAAVPromoterTruncated P5Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-10His-mStayGold (E138D)
Plasmid#211363PurposeMammalian expression of the bright and photostable monomeric StayGold fluorescent protein (E138D). Contains a N-terminal 10xHis tag.DepositorInsertmStayGold
Tags10xHis-tagExpressionMammalianMutationE138DPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-hM4D(Gi)-mCherry
Plasmid#50461PurposeDouble floxed Gi-coupled hM4D DREADD fused with mCherry under the control of EF1a promoterDepositorInserthM4D(Gi)-mCherry (CHRM4 Human)
UseAAVTagsHA and mCherryMutationSee supplemental documents for DREADD mutationsPromoterEF1aAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYL156 (TRV RNA2)
Plasmid#148969PurposeModified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)DepositorInsertModified TRV RNA2
UseT-dna vectorMutationsee comments section belowAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8s-WPRE (AAV1)
Viral Prep#162374-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP8s-WPRE (#162374). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Hygro
Plasmid#139462PurposeLentiviral vector with gRNA scaffold and hygromycin selectable markerDepositorInsertno sgRNA inserted; resistance gene: hygroR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only