169,450 results
-
Plasmid#234812PurposeTo express flourescent protein AmCyan from the Foxtail Mosaic Virus Vector (T-DNA)DepositorInsertAmCyan
ExpressionPlantAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-Cas9-2A-EGFP
Plasmid#167928PurposeDoxycycline-inducible Cas9 expression tracked by EGFP fluorescence marker.DepositorInsertT2A-EGFP
UseCRISPR and LentiviralExpressionMammalianPromotertTRE, hPGKAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.2.t1
Plasmid#73546PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.2.t1
pAzFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXJ-Myc-IRF8
Plasmid#232668Purposetransient expresses IRF8 in mammalian cellsDepositorAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_synNotch_Gal4VP64
Plasmid#79125PurposeLentiviral vector for constitutive expression of the anti-CD19 scFv synNotch Gal4DBDVP64 Receptor (PGK promoter)DepositorInsertantiCD19_synNotch_Gal4VP64
UseLentiviralAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Membrane Proteins (h6), top 5 sgRNAs/gene
Pooled Library#83985PurposeHuman CRISPRa Pooled Library targeting membrane proteinsDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDL-hu FceRI alpha
Plasmid#8365DepositorInserthuman Fc epsilon RI alpha cDNA (FCER1A Human)
ExpressionMammalianAvailable SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (AAV8)
Viral Prep#104492-AAV8PurposeReady-to-use AAV8 particles produced from pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (#104492). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7f-WPRE plasmid DNA. Syn-driven, Cre-dependent GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
SypHer
Plasmid#48250PurposepH sensorDepositorInsertSypHer
ExpressionMammalianMutationC199SPromoterCMVAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Puro shRNA Scramble
Plasmid#162011PurposeLentiviral negative control vector containing scramble shRNADepositorInsertscramble shRNA
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-BFP
Plasmid#188767PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM4D(Gi)-mCherry (AAV PHP.eB)
Viral Prep#44362-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (#44362). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM4D(Gi)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV were produced with the PHP.eB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCL/IFNB1-d2eGFP-3’UTR
Plasmid#180232PurposeReporter plasmid utilizing d2eGFP as a reporter gene. Expression is designed to mimick IFNB1DepositorInsertd2eGFP
UseLentiviralPromoter1 kb upstream of IFNB1 CDSAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/Myc-DNMT3A
Plasmid#35521PurposeMammalian expression of human DNMT3A with myc tagDepositorAvailable SinceMarch 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAG-TetON-3G
Plasmid#96963PurposeMammalian expression of Clontech rtTA driven by human beta-actin promoterDepositorTypeEmpty backboneExpressionMammalianAvailable SinceAug. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-UNC93A_STOP
Plasmid#161448PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertUNC93A (UNC93A Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB-CRISPR
Plasmid#160047PurposeFor cloning sgRNA to knockout a specific gene in piggybac plasmidDepositorTypeEmpty backboneUseCRISPR; PiggybacExpressionMammalianPromoterEFSAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
APEX2-V5-G3BP1_pTRE-G418
Plasmid#202013Purposeexpresses APEX2-G3BP1 in the mammalian cytosol under dox inducible promoter, lentiviral vectorDepositorInsertAPEX2-V5-G3BP1
UseLentiviralExpressionMammalianPromoterpTRE-TightAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB-cLUC
Plasmid#174051PurposeGateway compatible plasmid containing C-terminal luciferase for split-luciferase complementation assayDepositorTypeEmpty backboneUseLuciferaseExpressionPlantAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUGW
Plasmid#14883Purpose3rd gen lentiviral plasmid with hUbC-driven EGFP; can be used for cDNA expresionDepositorInsertflap-Ub promoter-GFP-WRE
UseLentiviralExpressionMammalianAvailable SinceMay 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRN112
Plasmid#84464PurposepJB38-NWMN29-30+ SarA_P1-mAmetrine-TermDepositorInsertSarA_P1-mAmetrine from pRN12
UseSynthetic BiologyAvailable SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
hMLKL-Venus
Plasmid#106078Purposeexpression in mammalian cellsDepositorInserthuman MLKL-Venus (MLKL Human)
UseRetroviral; Tet-on retrovirusTagsVenusExpressionMammalianPromoterDox-inducibleAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
VN-Tau (wt)
Plasmid#87368Purposeexpresses hTau fused to the N-terminal part of VenusDepositorAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE3G-dCas9-10X GCN4-P2A-mCherry
Plasmid#122132PurposeExpress a dCas9, 10X GCN4, and mCherry cassette from the TRE3G promoterDepositorInsertdCas9-10X GCN4-P2A-mCherry
UseCRISPR and LentiviralExpressionMammalianMutationdCas9 D10A & H840APromoterTRE3GAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
Human GeCKO Lentiviral sgRNA Library v2 (LentiCRISPR)
Pooled Library#1000000048PurposeCRISPR gRNA knockout pooled library for targeting the human genomeDepositorAvailable SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
phage UbiC G3BP1-GFP-GFP
Plasmid#119950PurposeLentiviral vector expressing G3BP1-GFP fusion proteinDepositorAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
9ao-SOD2-3xHA-TALE(ND4-Left)-Nt.BspD6I(C)
Plasmid#209293PurposemitoBE expression vector, target mtND4 gene.DepositorInsertSOD2-3xHA-TALE(ND4-Left)-Nt.BspD6I(C)
ExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-lck-GCaMP6f (AAV5)
Viral Prep#52924-AAV5PurposeReady-to-use AAV5 particles produced from pZac2.1 gfaABC1D-lck-GCaMP6f (#52924). In addition to the viral particles, you will also receive purified pZac2.1 gfaABC1D-lck-GCaMP6f plasmid DNA. gfaABC1D-driven (similar to GFAP promoter) lck-GCaMP6f calcium sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only