We narrowed to 5,890 results for: actin
-
Plasmid#73995PurposePlasmid expressing mouse Blimp1DepositorAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only
-
CAG sHRPb-NLG
Plasmid#73144PurposeSmall fragment of split HRP fused to the extracellular terminus of NLG1. CAG promoter.DepositorAvailable SinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 p53
Plasmid#59360PurposeLentiviral expression vector: p53 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorInsertsUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-B19G
Plasmid#59921PurposeExpression vector for Rabies virus SAD B19 glycoprotein geneDepositorInsertRabies virus glycoprotein
ExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT2-msfGFP
Plasmid#180318Purposemammalian expression of human SEPT2 fused to monomeric superfolder GFPDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Synapto-pHluorin
Plasmid#168510PurposeExpression of Synapto-pHluorin for optical monitoring of presynaptic release in neurons.DepositorAvailable SinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HA-Nrxn1beta AS4(+)
Plasmid#59410PurposeExpression plasmid for HA-tagged mouse Neurexin 1beta AS4(+) [containing the insert at alternatively spliced segment 4 (AS4+)]DepositorAvailable SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Co-InCreN
Plasmid#51267PurposeThe N-terminal component of the Co-InCre system, expresses the N-Cre-N-gp41-1 fusion that generates functional Cre by protein trans-splicing upon reacting with Co-InCreCDepositorInsertCo-InCreN
ExpressionMammalianPromoterCAGAvailable SinceMarch 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Co-InCreC
Plasmid#51268PurposeThe C-terminal component of the Co-InCre system, expresses the C-gp41-1-C-Cre fusion that generates functional Cre by protein trans-splicing upon reacting with Co-InCreNDepositorInsertCo-InCreC
ExpressionMammalianPromoterCAGAvailable SinceMarch 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBS31-cCARLIN
Plasmid#160928PurposeContains 10 constitutively expressed guide RNAs and CAG-GFP-CARLIN array sequence for DNA barcoding (when used in combination with Cas9)DepositorInsertCARLIN gRNAs and CAG-GFP-CARLIN array
UseMouse TargetingExpressionMammalianPromoterU6 promoter for gRNAs; CAG promoter for GFPAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-mRuby3-Gal8-P2A-Zeo
Plasmid#150815PurposeMammalian expression of mRuby3-Galectin8 (Gal8) fusion proteinDepositorInsertmRuby3-Gal8-P2A-Zeo (LGALS8 Synthetic, Human)
TagsGal8 is fused to the c-terminus of mRuby3ExpressionMammalianPromoterCAGAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Cas9-162A
Plasmid#84918Purposefor in vitro transcription of Cas9 with polyA tail encodedDepositorInsertCas9
TagsFlag, NLS, and polyA tailExpressionMammalianPromoterCAGAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-1BPNLS-Cas9-1BPNLS
Plasmid#87108PurposeBPNLS-Cas9-BPNLS expression plasmidDepositorInsert1BPNLS-Cas9-1BPNLS
UseCRISPRTags3xFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-dGBP1-TagBFP
Plasmid#80086PurposeGFP-dependent dGBP1-TagBFP, for expression in mammalian cellsDepositorInsertdGBP1-TagBFP
ExpressionMammalianPromoterCAGAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-CAG-RLuc
Plasmid#83280Purposerecombinant AAV vector packaging self-complementary Renilla Luciferase under the CAG promoterDepositorInsertRenilla Luciferase
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
PpyCAG-KLF2-IB
Plasmid#60441PurposeTransient human KLF2 expressionDepositorInsertKLF2 (KLF2 Human)
ExpressionMammalianAvailable SinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
mPA-GFP-Talin-ABM-10
Plasmid#57157PurposeLocalization: Talin Actin Binding Module, Excitation: 400 / 504, Emission: 515 / 517DepositorInsertTalin ABM
TagsmPA-GFPExpressionMammalianMutationActin Binding Module; I/LWEQ = 197 amino acids fr…PromoterCMVAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (AAV5)
Viral Prep#84446-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (#84446). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] plasmid DNA. CAG-driven, Cre-dependent expression of Jaws-KGC-tdTomato-ER2 for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-jGCaMP8f-WPRE (AAV9)
Viral Prep#179254-AAV9PurposeReady-to-use AAV9 particles produced from AAV-CAG-jGCaMP8f-WPRE (#179254). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8f-WPRE plasmid DNA. CAG-driven expression of calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only