We narrowed to 25,285 results for: crispr
-
Plasmid#216733PurposeExpresses SpCas9-D10A nickase under a CAG promoter together with a blasticidin resistance gene, along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Suitable for lentivirus packaging.DepositorPublicationInsertCas9-D10A nickase and sgCTG
UseCRISPR and LentiviralExpressionMammalianMutationD10APromoterU6 and CAGAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRM049 His-TEV-Cas9 triNLS 2C
Plasmid#196245PurposeExpression of NLS-rich Cas9 (2 Cys residues, mammalian codon optimized)DepositorInsertCas9
UseCRISPRTagsHA, His6 (N terminal on backbone), NLS, Nucleopla…ExpressionBacterialAvailable sinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRhaQCas-BsaI
Plasmid#170631PurposeExpression of CRISPR-associated transposasesDepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, CRISPR(BsaI)
ExpressionBacterialAvailable sinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tet-inducible mCherry reporter
Plasmid#64128PurposePhotoactivatable transcription system. mCherry reporter under the control of a tet-inducible promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry
ExpressionMammalianPromoterTetOx13-CMVAvailable sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
YE1-BE4max
Plasmid#138155PurposeC-to-T base editorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertrAPOBEC1(YE1)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 D10APromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEJS427-pCSDest2-AcrE2
Plasmid#85677PurposeMammalian expression of anti-CRISPR protein from Type I-EDepositorInsertType I-E anti-CRISPR
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDF0114 pU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
Plasmid#172508PurposeEncodes the mature DisCas7-11 DR along with a golden gate site for spacer cloningDepositorInsertpU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
ExpressionMammalianAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRN227
Plasmid#127222PurposeBeYDV replicon with 35S::Cas9, WUS2 and AtSTM, sgRNA targeting PDSDepositorInsertCas9, WUS2, AtSTM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
RfxCas13d-backbone
Plasmid#165078PurposeExpression of RfxCas13d sgRNAs from a U6 promoterDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertScaffold gRNA
ExpressionMammalianAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZDonor-Nm-Cas9-gRNA-hU6
Plasmid#61366Purposeempty backbone for cloning N. meningiditis protospacers. Encodes constant region of N. meningiditis Cas9 synthetic gRNADepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
v5 ABE-eVLP
Plasmid#228467PurposeExpresses MMLVgag(C507V)–ABE8e for producing v5 ABE-eVLPsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMMLVgag(C507V)–ABE8e
TagsFLAGExpressionMammalianMutationMMLVgag(C507V)PromoterCMVAvailable sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable sinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
CROP-sgRNA-MS2
Plasmid#153457PurposeCROP-seq vector with mCherry and x2 MS2 loops in gRNA scaffoldDepositorInsertsgRNA empty backbone
UseCRISPRExpressionMammalianAvailable sinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-pSFFV-dCas9-SunTag-P2A-BFP-dWPRE
Plasmid#122151PurposeExpresses dCas9-SunTag(24X) fusion and a fluorescent indicator BFP.DepositorInsertdCas9 fused to SunTag(24x)
UseLentiviralTags2xNLS-P2A-BFP and NLSExpressionMammalianPromoterSFFVAvailable sinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-dCas13-M3M14nes
Plasmid#155367PurposeTargeted m6A RNA methylation in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUseCRISPRExpressionMammalianMutationPspCas13b Δ984-1090 H133AAvailable sinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZ8-Ptac
Plasmid#74064PurposeIPTG inducible version of pZ8-1 plasmid, to which lacIq was added, KanRDepositorPublicationTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterptacAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pABE8e-protein
Plasmid#161788PurposeRhamnose-inducible expression of 8xHIS-ABE8e in E. coliDepositorInsertABE8e base editor
Tags8xHIS and BPNLSExpressionBacterialPromoterpRhaBADAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ9757: CMV-BPNLS_TadA-linkerA-TadA*(8e)-Linker B-SV40 NLS-dCasMINI-V4-linkerC-c-Myc_NLS-3x FLAG-polyA
Plasmid#176270PurposeExpression of TadA-TadA* (8e)-dCasMINI-V4 in mammalian cellsDepositorInsertTadA-TadA*(8e)-dCasMINI-V4
ExpressionMammalianPromoterCMVAvailable sinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only