We narrowed to 9,450 results for: tre promoter
-
Plasmid#62579PurposeTranslational Luciferase Reporter encoding a fragment of the 3'UTR of SPRED1 containing two miR-21 binding sites (sites 1 and 2)DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7A)-ATOH1 (SA Substitutions)
Plasmid#172309PurposeIn vitro transcription of ATOH1 (Ser phosphosites substituted by Ala)DepositorAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-hPIKfyve
Plasmid#121148PurposeExpresses GFP-tagged human PIKfyve in mammalian cells.DepositorInsert1-phosphatidylinositol 3-phosphate 5-kinase isoform 2 (PIKFYVE Human)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a MICA*009-IRES-ZsGreen
Plasmid#114007PurposeInduces expression of human MICA allele 009 cDNADepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a-MICB*005-IRES-ZsGreen
Plasmid#114008PurposeInduces expression of human MICB allele 005 cDNADepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionPromoterArabidopsis U6 polymerase III promoterAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
yeast_DualReporter
Plasmid#127546PurposeA dual reporter vector modified from Sharon et al (Nature Biotech, 2012) containing Ura3 and Nat1 selectable markers, a constant background RFP (TEF2::mCherry), and a variable YFP (pTpA+MCS::yEVenus).DepositorInsertsUseSynthetic BiologyExpressionYeastPromoterTEF, TEF2, URA3, bla (E. coli), and pTpA+MCSAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-P33-shR
Plasmid#208359PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22b-P33 mutantDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations (shRNA resistance), 33 aa p…PromoterCMVAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL2del
Plasmid#216742PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 2 (OL2) by examining the variant lacking OL2 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
Tags8x HisExpressionBacterialMutationOuter loop 2 (OL2) with the sequence of [LEDSGYMA…Available SinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL4del
Plasmid#216744PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 4 (OL4) by examining the variant lacking OL4 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
Tags8x HisExpressionBacterialMutationOuter loop 4 (OL4) with the sequence of [TLDGKPVQ…Available SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL5del
Plasmid#216745PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 5 (OL5) by examining the variant lacking OL5 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
Tags8x HisExpressionBacterialMutationOuter loop 5 (OL5) with the sequence of [ATFAA] i…Available SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL1del
Plasmid#216741PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 1 (OL1) by examining the variant lacking OL1 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
Tags8x HisExpressionBacterialMutationOuter loop 1 (OL1) with the sequence of [INIGGALQ…Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1213 - pL0_p16OMT (pro + 5U)
Plasmid#203890Purpose16OMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsert16OMT promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1214 - pL0_pNMT (pro + 5U)
Plasmid#203893PurposeNMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertNMT promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆sap-NLS-3XFLAG-V5
Plasmid#196091PurposeExpresses mouse SAFB lacking the n-terminal SAP domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 31-65 (SAP domain) of mouse S…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆rrm-NLS-3XFLAG-V5
Plasmid#196093PurposeExpresses mouse SAFB lacking the rrm domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 428-506 (RRM) of mouse SAFB p…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-mCherry
Plasmid#122959PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with mCherry expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xmyc tagMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-EGFP
Plasmid#122956PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xhis tagMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd1-NLS-3XFLAG-V5
Plasmid#196092PurposeExpresses mouse SAFB lacking the first computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 96-285 (predicted disordered …PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd3-NLS-3XFLAG-V5
Plasmid#196094PurposeExpresses mouse SAFB lacking the third computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 638-925 (predicted disordered…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-SAFB-DD3-NLS-3XFLAG-V5
Plasmid#196095PurposeExpresses only the third computationally called disordered domain of mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationContains only AA 619-925 (NLS and predicted disor…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta EGF repeats (N2NL-delta EGF)-ires-EGFP
Plasmid#122955PurposeLentiviral expression of NOTCH2NL delta EGF repeats under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta EGF repeats (NOTCH2NLB Human)
UseLentiviralTags6xhis tagMutationdeletion of EGF repeats from full length NOTCH2NLBPromoterCAG promoterAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PtenWT-Puro
Plasmid#135676PurposeConstitutive expression (cMV promoter) of wildtype Pten cDNA, Puromycin selectionDepositorInsertPten (Pten Mouse)
UseLentiviralAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
TYK2A-c075
Plasmid#53688PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACYCduet-mxLOX2-EH
Plasmid#104979PurposeBiosynthesis of oxylipins by microbial enzymesDepositorExpressionBacterialPromoterT7 promoterAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-ABEmax-P2A-EGFP-ires-puro
Plasmid#121170PurposeCAG promoter driven expression of ABEmax base editor, EGFP and Puromycin resistance.DepositorInsertABEmax-P2A-EGFP-ires-puro
UseCRISPRTagsP2A-EGFP-ires-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-FNLS-T2A-EGFP-ires-puro
Plasmid#121169PurposeCAG promoter driven expression of FNLS BE3 base editor, EGFP and Puromycin resistance.DepositorInsertFNLS-T2A-EGFP-ires-puro
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-xFNLS-T2A-EGFP-ires-puro
Plasmid#121171PurposeCAG promoter driven expression of xFNLS BE3 base editor, EGFP and Puromycin resistance.DepositorInsertxFNLS-T2A-EGFP-ires-puro
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-tRNA-SpCas9
Plasmid#195183PurposeVector for transient Cas9 and EGFP expression. Small tRNA promoter for sgRNA cloning by GoldenGate.DepositorInsertCas9
UseCRISPRPromotertRNA-GlnAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E-elavl3
Plasmid#72640PurposeGateway p5E 5'entry clone with elavl3 (HuC) enhancer/promoter for pan-neuronal expression in zebrafishDepositorInsertelavl3 enhancer (elavl3 Zebrafish)
Available SinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
JDS246
Plasmid#43861PurposeExpresses mammalian codon optimized Cas9 nuclease with C-term 3X FLAG from CMV and T7 promotersDepositorInsertmammalian codon-optimized streptococcus pyogenes Cas9 - 3X Flag
UseCRISPRTags3X FLAGExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-DIPP3B-HA
Plasmid#183949PurposeExpresses human HA-tagged DIPP3B from yeast GPD promoterDepositorAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
AbVec2.0-mIghg2c
Plasmid#127159PurposeExpression of secretory immunoglobulin heavy chains in mammalian cells, mouse (C57BL/6), IgG2c isotypeDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSil-XIAP
Plasmid#58832PurposeExpress human apoptosis inhibitor XIAP from CAG promoterDepositorAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
M71 pGL3 Sp5l P1203 mut
Plasmid#17209DepositorInsertSp5l promoter (sp5l Zebrafish)
UseLuciferaseTagsluciferaseMutation6 of the putative Tcf/Lef sites mutatedAvailable SinceMay 18, 2009AvailabilityAcademic Institutions and Nonprofits only -
AbVec2.0-mIghg1
Plasmid#127158PurposeExpression of secretory immunoglobulin heavy chains in mammalian cells, mouse (C57BL/6), IgG1 isotypeDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -