31,690 results
-
Plasmid#247938PurposeExpression of human LONP1 with methionine 115 as its first residue (mature mitochondrial-matrix localized form) and Walker B mutant (E591A)DepositorInsertLONP1 (LONP1 Human)
Tags6xHisExpressionBacterialMutationencodes aa 115-959, with E591APromoterT7Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
NBla_1.2_EmrE_TMD4_3P_G90V_G97V
Plasmid#207847PurposeBLaTM-System; Antiparallel negativecontrol EmrE_TMD4_3P_G90V_G97V in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P
Plasmid#207846PurposeBLaTM-System; Antiparallel positive control EmrE_TMD4_3P in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCT5-bac1.8
Plasmid#119871PurposeConstitutive expression of sfGFP gene in Bacillus subtilis, B. megaterium, and Escherichia coliDepositorInsertsCymR'
sfGFP
UseSynthetic BiologyExpressionBacterialMutationSNP in 592 bpPromoterPserA promoter and Pveg promoter with CuO sequenceAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRBC-sfGFP wild type
Plasmid#174075PurposePlasmid with p15a origin of replication expressing codon optimized superfolder GFP with C-terminal His6 tag, under T7 promoterDepositorInsertSuperfolder GFP
TagsHis-6ExpressionBacterialPromoterT7Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-CUL4A-pCMV7.1
Plasmid#155022PurposeN-terminal 3xFLAG-tagged CUL4A in a pCMV7.1 vectorDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-pBAD
Plasmid#54762PurposeLocalization: Protein Expression Vector , Excitation: 488, Emission: 507DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags6xHis and EGFPExpressionBacterialAvailable SinceJuly 25, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
3xFLAG-CUL3-pCMV7.1
Plasmid#155021PurposeN-terminal 3xFLAG-tagged CUL3 in a pCMV7.1 vectorDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI3M-TBD
Plasmid#113077PurposeExpresses enCas9 fused to PolI3M-TBD in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI3M-TBD
ExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-Bsu
Plasmid#163911PurposeExpresses Bsu large fragment for affinity purificationDepositorInsertBsu polymerase
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ubiquitin WT
Plasmid#12647DepositorAvailable SinceJuly 31, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSmartBAC-S
Plasmid#107268PurposeBroad host range bacterial artificial chromosome vectorDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDisCoTune
Plasmid#173713PurposePromotes expression of disulfide-rich protein in E. coli T7 expression system. The plasmid encodes expression of the folding factors Erv1p and hPDI controlled by the Ptac promoter.DepositorInsertsExpressionBacterialAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only