1,782 results
-
-
pSEM231 - [Pmlc-1 | gfp | cbr-tbb-2 UTR]
Plasmid#159897PurposeFluorescent co-injection marker to identify extrachromosomal arrays in C. elegansDepositorInsertPmlc-1 | gfp | cbr-tbb-2 UTR
ExpressionWormAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDJ113 - pEXP(HygroR, 5605)[Phsp-16.41 |Cre recombinase (PATCs) | tbb-2 UTR]
Plasmid#159809PurposeOptimized enzyme for genome editing in C. elegansDepositorInsertpEXP(HygroR, 5605)[Phsp-16.41 |Cre recombinase (PATCs) | tbb-2 UTR]
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2440 - [1-2] ENTR - Fluor - ce-GFP(PATCs(900bp), no_atg, no stop)
Plasmid#159849PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-GFP(PATCs(900bp), no_atg, no stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Punc-4::NGL-1::spGFP1-10
Plasmid#65827PurposeFor trans-synaptic labelingDepositorAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2059 - [1-2] ENTR - Tag - Halo (intron(1), syntrons(3), no_atg, no_stop)
Plasmid#159872PurposeThree-fragment Gateway compatible protein tag for expression in C. elegansDepositorInsert[1-2] ENTR - Tag - Halo (intron(1), syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMLS328
Plasmid#73717PurposeC. elegans germline CRE expression vectorDepositorInsert2xNLS-CRE
UseCre/LoxExpressionWormPromoterPeft-3Available SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPK605
Plasmid#38148DepositorInsertsunc-119 rescuing fragment (unc-119 promoter, unc-119 and unc-119 3'UTR) (unc-119 Nematode)
pie-1 promoter - unique MluI/BamHI cloning site - pie-1 3'UTR
ExpressionWormPromoterpie-1 promoter and unc-119Available SinceOct. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHW449
Plasmid#198805PurposeDirect light-gated cation channel from Chlamydomonas reinhardtii that allows neuron deploarization through brief pulses of blue light.DepositorInsert15xUAS::hChR2(H134R)-YFP::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD284
Plasmid#66825PurposeTagRFP-T^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertTagRFP-T-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized TagRFP-TExpressionWormAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ccas9LacZ
Plasmid#113083PurposeEnhanced C. elegans Cas9 vector. Ccas9LacZ contains a lacZ coding sequence, two Cas9 and two type-IIs restriction enzyme recognition sites next to the U6 promoter and gRNA sequences.DepositorTypeEmpty backboneUseCRISPRExpressionWormAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM656
Plasmid#53086PurposeA non-Phosphatidylserine binding mutant form of Lactadherin(sGFP::LactC1C2mut) to be used as a controlDepositorInsertLactaherin (Mfge8 Mouse)
TagsGFP (w/ introns) and signal sequenceExpressionWormMutationdeleted native signal sequence, deleted C-termina…Promoterhsp-16.41Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSH83
Plasmid#212989Purposeexpresses miniSOG in C. elegansDepositorAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2060 - [1-2] ENTR - Tag - Snap (intron(1), syntrons(3), no_atg, no_stop)
Plasmid#159873PurposeThree-fragment Gateway compatible protein tag for expression in C. elegansDepositorInsert[1-2] ENTR - Tag - Snap (intron(1), syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJL049
Plasmid#198809PurposeIn vivo calcium indicator. Presence of calcium (Ca2+) increases reporter signal intensity.DepositorInsert15xUAS::GCaMP6s-SL2-mKate2::let-858 3'UTR
ExpressionWormAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ150-mCherry(dpiRNA)::ANI-1(AHPH)
Plasmid#107939Purposepie-1p::mCherry(dpiRNA)::ANI-1(AHPH)::pie-1 3'UTR construct used for MosSCI in nematode. mCherry is optimized by removing all piRNA targeting sites to allow germline expression. RhoA biosenser.DepositorInsertmCherry(dpiRNA)::ANI-1(AHPH)
ExpressionWormPromoterpie-1Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJW1219
Plasmid#61250PurposeCRISPR/Cas9 plasmid containing sgRNA(F+E); for use in C. elegansDepositorInsertsgRNA(F+E)
UseCRISPRExpressionWormPromoterU6 promoterAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCFJ108 - pENTR221 - [cbr-unc-119(+)]
Plasmid#200367Purposecbr-unc-119 rescue gene for use as co-injection marker.DepositorInsert[cbr-unc-119(+)]
ExpressionWormAvailable SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJW2171
Plasmid#163095PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::AID*::3xFLAG::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only