We narrowed to 50 results for: PAP1
-
Plasmid#71258Purposeluciferase reporter with 3 copies of the stromelylisin gene AP-1 site in front of hGM-CSF -55 to +28 minimal promoterDepositorInsert3 copies of an AP-1 site from the human Stromelysin-1 gene (MMP3 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGM-CSF minimalAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP114
Plasmid#120799PurposeE. coli-C. difficile shuttle vector for xylose-inducible expression in C. difficile; Pxyl driving expression of red fluorescent protein (mCherryOpt)DepositorInsertPxyl::mCherryOpt
ExpressionBacterialMutation1.4 kb xylR-Pxyl DNA fragment from C. difficile R…PromoterPxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAP118
Plasmid#105495PurposepRPF185 derived plasmid encoding an anhydrotetracyclin inducible HupA-SmBiT and HupA-LgBiT fusionsDepositorInsertHupA-SmBiT/HupA-LgBiT
UseAtc-dependent expression in c. difficilePromoterPtetAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1698-4
Plasmid#105242Purposemammalian eGFPDepositorInserteGFP
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1638
Plasmid#137089PurposePlasmid for PCR-generated donor DNA for rapid tagging of proteins with 4*(GFP11)DepositorInsert4*(GFP11)
UsePcr template for donor dnaExpressionBacterialAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP1836
Plasmid#137087PurposePlasmid for PCR-generated donor DNA for rapid tagging of proteins with mCherryDepositorInsertmCherry
UsePcr template for donor dnaExpressionBacterialAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP1837
Plasmid#137086PurposePlasmid for PCR-generated donor DNA for rapid tagging of proteins with mCherryDepositorInsertmCherry
UsePcr template for donor dnaExpressionBacterialAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAP1680
Plasmid#137088PurposePlasmid for PCR-generated donor DNA for rapid tagging of proteins with tagRFPDepositorInserttagRFP
UsePcr template for donor dnaExpressionBacterialAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pAP113
Plasmid#247098PurposeContains RebHEvo4DepositorInsertRebHEvo4
ExpressionBacterialMutationA16S, A32V, D101N, V256I, Q323H, N326K, T348A, T3…Available SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAP114
Plasmid#247100PurposeContains Fre-L3-RebHEvo4DepositorInsertFre-L3-RebHEvo4
ExpressionBacterialMutationA16S, A32V, D101N, V256I, Q323H, N326K, T348A, T3…Available SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1071-2
Plasmid#99502Purpose3XFlag::meGFP with 2 introns::Ollas::H2B::tbb-2 3utr::linker::TEVDepositorInsert3XFlag::meGFP with 2 introns::Ollas::H2B::tbb-2 3’utr::linker::TEV
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-LRPAP1
Plasmid#31327DepositorInsertlow density lipoprotein receptor-related protein associated (LRPAP1 Human)
TagsHis and TEVExpressionBacterialAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gapAP1
Plasmid#87146PurposegapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV rat SAPAP1
Plasmid#47940PurposeExpresses rat SAPAP1 in mammalian cellsDepositorAvailable SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCIneoMyc rat SAPAP1
Plasmid#40215DepositorAvailable SinceNov. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
Anti-SAPAP1 [N238/29]
Plasmid#190303PurposeMammalian Expression Plasmid of anti-SAPAP1 (Rat). Derived from hybridoma N238/29.DepositorInsertanti-SAPAP1 (Rattus norvegicus) recombinant Mouse monoclonal antibody (Dlgap1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-SAPAP1 [N238/30]
Plasmid#190304PurposeMammalian Expression Plasmid of anti-SAPAP1 (Rat). Derived from hybridoma N238/30.DepositorInsertanti-SAPAP1 (Rattus norvegicus) recombinant Mouse monoclonal antibody (Dlgap1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-SAPAP1/2 [N238/31R]
Plasmid#182110PurposeMammalian Expression Plasmid of anti-SAPAP1/2 (). Derived from hybridoma N238/31.DepositorInsertanti-SAPAP1/2 () recombinant mouse monoclonal antibody
ExpressionMammalianPromoterDual CMVAvailable SinceAug. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2-GapAP1
Plasmid#87150PurposegltA1-gltA2-GapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
DPAP1-COMP-blac-flag-his
Plasmid#111019PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertcathepsin C, homolog,dipeptidyl aminopeptidase 1 (DPAP1) (PF11_0174 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2-udhA-GapAP1
Plasmid#87151PurposegltA1-gltA2-udhA-GapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-udhA-GapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-gapAP1
Plasmid#87147PurposefabI-gltA1-gltA2-gapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-udhA-gapAP1
Plasmid#87154PurposefabI-gltA1-gltA2-udhA-gapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-udhA-GapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-udhA-zwf-gapAP1
Plasmid#87149PurposefabI-gltA1-gltA2-udhA-zwf-gapAP1 targeting guide RNA E. coli, Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-udhA-zwf-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNW538_pAAVS1-pAP1(2)-FlpO-ABI-P2A-PYL-FlpO-CAG-U1-frt-STOP-frt-U2-GFP-P2A-luc2-ZeoR
Plasmid#192939PurposeFlpO-based digitizer circuit driven by AP1 promoterDepositorInsertsAP1(2)/minTK promoter
FlpO-ABI
PYL-FlpO
CAG promoter
frt-STOP-frt
GFP
luciferase
pPGK
Zeocin resistance
BFP
UseSynthetic BiologyExpressionMammalianAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PAP-delta10-cHIS
Plasmid#21716DepositorInsertpolyA polymerase (PAP1 Budding Yeast)
TagsHISExpressionBacterialMutation30 amino acids off the c terminusAvailable SinceAug. 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-PDAP1
Plasmid#31586DepositorAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET3a pro-hRegIIIa
Plasmid#64935Purposebacterial expression of full length human RegIIIalphaDepositorInsertRegIIIa (REG3A Human)
ExpressionBacterialMutationmutations made in 5' end to relax secondary …PromoterT7Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET3a hRegIIIa
Plasmid#64937Purposebacterial expression of processed human RegIIIalphaDepositorInsertRegIIIa (REG3A Human)
ExpressionBacterialMutationprocessed form. mutations made in 5' end to …PromoterT7Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCRL2-COMP5AP-AviTag-9xHis
Plasmid#157376PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCRL2-Fc(DAPA)-AviTag-6xHis
Plasmid#156812PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCRL2 (FCRL2 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mLPIN1
Plasmid#60803PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LPIN1 3' UTR and mutated miR-155 sitesDepositorInsertLPIN1 3'UTR and mutated miR-155 binding site (LPIN1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 LPIN1
Plasmid#60802PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LPIN1 3' UTR and wild-type miR-155 sitesDepositorInsertLPIN1 3'UTR and wild-type miR-155 binding site (LPIN1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRK5 FLAG membrane-bound lipin-1 (TMD)
Plasmid#120277PurposeExpression of ER/Golgi-tethered lipin-1 in mammalian cellsDepositorInsertLipin-1 (Lpin1 Mouse)
TagsFLAG and in-frame fusion with the TMD Golgi-local…ExpressionMammalianPromoterCMVAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK5 FLAG membrane-bound lipin-1 (delta200)
Plasmid#120278PurposeExpression of ER/Golgi-tethered lipin-1 in mammalian cellsDepositorInsertLipin-1 (Lpin1 Mouse)
TagsFLAG and in-frame fusion with the delta200 Golgi-…ExpressionMammalianPromoterCMVAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
hRAP-pEZT-BM
Plasmid#177986PurposeExpression human RAP containing a C-terminal 6xHis tag in mammalian cellsDepositorInsertLDL receptor related protein associated protein 1 (LRPAP1 Human)
Tags6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
RAPpGEX
Plasmid#162241PurposeExpresses LDL-receptor associated protein (RAP), full length in mammalian cellsDepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_REG3A_WT
Plasmid#81826PurposeGateway Donor vector containing REG3A , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_REG3A_p.P109S
Plasmid#81315PurposeGateway Donor vector containing REG3A , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_REG3A_p.G85R
Plasmid#81299PurposeGateway Donor vector containing REG3A , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
V5-Apex2-RAP
Plasmid#241358PurposeThe V5-Apex2-RAP is a fusion between Apex2 and RAP for recombinant protein production.DepositorAvailable SinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
CALM-pmCherryN1
Plasmid#27691DepositorAvailable SinceMay 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN170
Plasmid#91599PurposeExpress sgRNA targeting human DLGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN171
Plasmid#91600PurposeExpress sgRNA targeting human DLGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only