We narrowed to 137 results for: G2
-
Plasmid#25917DepositorInsertSFFV promoter, eGFP
UseLentiviralExpressionMammalianAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSP-G2
Plasmid#64737PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g2
Plasmid#153012PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing mCherryDepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL2-G2
Plasmid#137091PurposeiFLinkC Linker cloningDepositorInsertGG
UseSynthetic BiologyAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g2
Plasmid#153016PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing mCherryDepositorInsertTMPRSS2 gRNA
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
LeGO-hEµMAR-G2
Plasmid#52633Purpose3rd generation lentiviral vector for enhanced eGFP expression/marking in primary B cells and B-cell linesDepositorInserthEµMAR-SFFV; eGFP
UseLentiviralExpressionMammalianAvailable SinceJuly 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g2
Plasmid#80785PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 2/12/22 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianPromoterU6Available SinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G2-Km
Plasmid#46815PurposeTEF1 and PGK1 promoter controlled expression cassettes with G418 resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDule2-IBBN (G2)
Plasmid#85501PurposePlasmid for incorporating the non-canonical amino acid IBBN with the Mj IBBN (G2) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertIBBN (G2) synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
ExpressionBacterialMutationY32G L65E F108W Q109M D158S R162KPromoterlpp (constitutive)Available SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G2-Ph
Plasmid#46816PurposeTEF1 and PGK1 promoter controlled expression cassettes with phleomycin resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDule-IBBN (G2)
Plasmid#85500PurposePlasmid for incorporating the non-canonical amino acid IBBN with the Mj IBBN (G2) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertIBBN (G2) synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
ExpressionBacterialMutationY32G L65E F108W Q109M D158S R162KPromoterlpp (constitutive)Available SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgSORCS2-G2
Plasmid#118416PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting Human SORCS2DepositorInsertgRNA SORCS2 Human (SORCS2 Human)
UseCRISPR and LentiviralAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP6 DdCBE G2
Plasmid#221951PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-T-ATP6 TALE G2 repeats-TALE CTD-DddAtox 1397N-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianMutationSee depositor commentsPromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP6 alphaDdCBE G2
Plasmid#221959PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-alphaN-ATP6 TALE G2 repeats-TALE CTD-DddAtox 1397N-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianMutationTALE: Q231R, W232G, S233A, See depositor commentsPromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g2
Plasmid#120210PurposeCENPB CRISPRi guide RNA 2DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARB (pKD-G2)
Plasmid#62681PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCBEclos-cbei2385-g2-opt
Plasmid#118215PurposeCRISPR-mediated base editing in ClostridiumDepositorInsertApobec1, Casp nickase, UG1-sgRNA
ExpressionBacterialPromoterPtmAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G2-Km ymNeongreen
Plasmid#193959PurposeTEF1 promoter controlled expression plasmid with G418 resistance for expressing ymNeongreen in budding yeastDepositorInsertymNeonGreen
ExpressionYeastPromoterTEF1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only