167,150 results
-
Plasmid#201234PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-VP16-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GAL4BD-GWY/pAM
Plasmid#201233PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GAL4BD-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MMLVgag-D3A-3L-dCas9-ZIM3
Plasmid#240531PurposeExpresses MMLVgag–DNMT3A-3L-dCas9-ZIM3 for producing RENDER-DNMT3A-3L-dCas9-ZIM3DepositorInsertMMLVgag-D3A-3L-dCas9-ZIM3
TagsFLAG, HAExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-GAL4BD/pAM
Plasmid#201231PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GWY-GAL4BD
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-VP16/pAM
Plasmid#201232PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-GWY-VP16
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
phMYT1L-N174
Plasmid#66809Purpose2nd generation lentiviral transfer plasmid. Expresses human MYT1L with G418 resistanceDepositorAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti dCAS-VP64_Blast
Plasmid#61425Purpose3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)DepositorHas ServiceLentiviral PrepInsertdCAS9(D10A, N863A)-VP64_2A_Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1AAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRES-EGFP-puro
Plasmid#45567DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsIRES-EGFP-PuroExpressionMammalianPromoterPhcmv (strong human cytomegalovirus immediate ear…Available SinceJune 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(4)P Probe
Plasmid#211509PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-4-Phosphate (PI(4)P) from bacteriaDepositorInsertSidC (P4C)
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
phDLX1-N174
Plasmid#60859Purpose2nd generation lentiviral transfer plasmid. Expresses DLX1 under the EF1a promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3,5)P2 Probe
Plasmid#211512PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3,5-Bisphosphate (PI(3,5)P2) from bacteriaDepositorInsertSnxA-2xPX
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3)P Probe
Plasmid#211508PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3-Phosphate (PI(3)P) from bacteriaDepositorAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GNSTM-3-RVG-10-Lamp2b-HA
Plasmid#71294PurposeEncodes (N to C): GNSTM glycosylation motif, 3 residue spacer, RVG peptide, 10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
TagsGNSTM glycosylation motif, HA, Lamp2 signal pepti…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCbs FlagOmomyc
Plasmid#113168PurposeExpression of FLAG tagged Omomyc in mammalian cellsDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_g5-HT3.0
Plasmid#208711PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0 in mammalian cellsDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-Puro
Plasmid#86708PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the puromycin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only