We narrowed to 23,118 results for: Sis
-
Plasmid#105127PurposeUsed along with I-SceI enzyme to generate transgenic zebrafish expressing hepatocyte-specific Xenopus activated beta-catenin and lens-specific Venus fluorescent proteinDepositorInsertsUseZebrafish transgenesisPromotercryaa (crystallin) and fabp10aAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only
-
Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
Plasmid#207355PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK6
Plasmid#23781DepositorInsertNEK6 (NEK6 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK8
Plasmid#23418DepositorInsertNEK8 (NEK8 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-AID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK5
Plasmid#23434DepositorInsertNEK5 (NEK5 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TSSK3
Plasmid#23553DepositorInsertTSSK3 (TSSK3 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK3
Plasmid#23821DepositorInsertNEK3 (NEK3 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Venus
Plasmid#105805PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Venus, cleavable by TEV. Useful for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-VenusExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187963PurposemAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertsAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linker and T2AExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABE-RPS14(WT)-Myc
Plasmid#122235Purposeexpresses RPS14 protein with a Myc tag in mammalian cells (puro resistance)DepositorAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-NENF-C-TAP
Plasmid#128511PurposeLentiviral constitutive expression of CRISPR-resistant NENF with c-terminal FLAG and HA tag.DepositorInsertNENF (NENF Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationSynonymous silent mutations to F81, Y82, G83 and …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-XRCC1-gRNA res-Neo
Plasmid#176149PurposeXRCC1 with dual PAM resistance to XRCC1 gRNA1 and XRCC1 gRNA2 & a neomycin/G418 resistance cassetteDepositorInsertX-ray repair cross complementing 1 (XRCC1 Human)
UseLentiviralExpressionMammalianMutationDual PAM resistance to XRCC1 gRNA 1 and XRCC1 gRN…PromoterCMVAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TSSK1
Plasmid#23740DepositorInsertTSSK1 (TSSK1B Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA0482
Plasmid#96968Purposeexpression of methicillin-resistant Staphylococcus aureus orf 0482DepositorInsertMRSA ORF0482
TagsN-ter TEV protease cleavable 6HisExpressionBacterialMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK4
Plasmid#23497DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK11
Plasmid#23816DepositorInsertNEK11 (NEK11 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-STK17B
Plasmid#23721DepositorInsertSTK17B (STK17B Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TSSK2
Plasmid#23397DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK10
Plasmid#23437DepositorInsertNEK10 (NEK10 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Amber
Plasmid#105806PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Amber, cleavable by TEV. Control for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-AmberExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast HA-GPAT4-ΔNs5
Plasmid#173169PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4 with mutation in CHP1 binding siteDepositorInsertGlycerol-3-Phosphate Acyltransferase 4 (GPAT4 Human)
UseRetroviralTagsHAMutationSynonymous mutations at sgRNA sites, amino acids …PromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast 3XFLAG-CHP1-myr_mut
Plasmid#173167PurposeRetroviral vector to express sgRNA resistant 3XFLAG tagged human CHP1 with myristoylation site mutationDepositorInsertCalcineurin Like EF-Hand Protein 1 (CHP1 Human)
UseRetroviralTags3XFLAGMutationSynonymous mutations at sgRNA sites, G2A, S6APromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-RPS14(WT)-Myc
Plasmid#122236Purposeexpresses RPS14 protein with a Myc tag in mammalian cells (hygro resistance)DepositorAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-tevopreQ1-epegRNA+13C>G_EF1a-puroR (PBS 14 - RTT 18)
Plasmid#207356PurposeLentiviral transfer plasmid encoding hU6-driven expression of a N1303K-CFTR correcting prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR + 13 C>G tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2-RNA-MUT (nonsense mutation of sgYTHDF2-1)
Plasmid#232948PurposeExpresses the RNA-binding-deficient mutant of YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-RNA-MUT (YTHDF2 Human)
UseLentiviralMutationRNA binding mutation (K416A+R527A), synonymous mu…Available SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE_DLD-S456A-C-TAP
Plasmid#83479PurposeMammalian expression of the proteolysis-deficient mutant DLD-S456A.DepositorAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGGG-Sr43
Plasmid#186974PurposeSr43 is a wheat stem rust resistance gene transferred from tall wheat grass (Thinopyrum ponticum) into bread wheat (Triticum aestivum).DepositorInsertSr43
TagsNoneExpressionBacterial and PlantMutationNonePromoterNaticeAvailable SinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-tevopreQ1-epegRNA+13C>A_EF1a-puroR (PBS 10 - RTT 19)
Plasmid#207357PurposeLentiviral transfer plasmid encoding hU6-driven expression of a L227R-CFTR correcting prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR + 13 C>A tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7(res) (closed)
Plasmid#160105PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ALS2CR7
Plasmid#23632DepositorInsertALS2CR7 (CDK15 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only