We narrowed to 165,567 results for: addgene
-
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
7TG
Plasmid#24314DepositorInsert7xTcf-eGFP
UseLentiviralMutationEGFP is GFP with S65T and F64L mutationsAvailable SinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-Stuffer-HepmCherry
Plasmid#192825PurposeContains stuffer sequence into which sgRNAs can be cloned and expresses mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterHepatocyte-specific promoter (HS-CRM8-TTRmin modu…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti UBC hNLRP3-mNG
Plasmid#218642PurposeExpresses NLRP3 tagged with mNeonGreen in mammalian cells (lentiviral); driven by the weak UBC promoter with puro selectionDepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-rtTR-KRAB
Plasmid#11777PurposeTet-regulated (Tet-off) lentiviral vector for transgene (mPGK promoter) - AND/OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInsertmPGK, GFP, rtTR-KRAB, Tet-off
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSNAPf-Nup43
Plasmid#98276Purposemammalian expression of SNAPf-Nup43DepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
6BHD (SETDB1)
Plasmid#119955PurposeBacterial expression for structure determinationDepositorInsertSETDB1 (SETDB1 Human)
Tags6xHis-TEVExpressionBacterialMutationcontains amino acids 190-410PromoterT7Available SinceFeb. 1, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::PuroR-bGHpA
Plasmid#62439PurposeMXS_chaining vector with CMV::PuroR-bGHpADepositorInsertresistance cassette against Puromycin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNR64
Plasmid#79540PurposeInput plasmid: expresses two recombinases downstream of two inducible promoters. Same as Dual-Recombinase-Controller (plasmid #44456) from Endy Lab except with KanR instead of CamR on the backbone.DepositorInsertsTP901
BxbI
TagsHis tag and LAA degradation tagExpressionBacterialAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pL1P5 ZmUbiP:GRF-GIF:NosT
Plasmid#198046PurposeMoClo Golden Gate Level 1 Position 5. Overexpression cassette of Growth-Regulating Factor 4 (GRF4) plus GRF-Interacting Factor 1 (GRF4-GIF1). Improves in vitro wheat regeneration and transformation.InsertZmUbiP::TaGRF4-GIF1::NosT
UseSynthetic BiologyPromoterZea mays (maize) ubiquitin promoterAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIgnaviCas9
Plasmid#127595PurposeExpresses IgnaviCas9 in E. coliDepositorInsertIgnaviCas9
Tags6xHis Tag and Maltose binding proteinExpressionBacterialPromoterT7 promoterAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHPyV7-713a
Plasmid#24728DepositorInsertFull genome of Human polyomavirus 7
UseViral cloneAvailable SinceJune 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
ICP8-P2A/Crimson (pSLIK4)
Plasmid#113859PurposeFor Doxycycline-inducible expression of ICP8 synaptase gene, with ICP8-P2A-red fluorescent protein gene E2-CrimsonDepositorInsertICP8
UseLentiviralTagsP2A/CrimsonAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBEVY-T
Plasmid#51232Purposebi-directional expression vector for yeast, constitutively active, TRP1 selectionDepositorTypeEmpty backboneExpressionYeastPromoterGPD/ADH1Available SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHPyV6-607a
Plasmid#24727DepositorInsertFull genome of Human polyomavirus 6
UseViral cloneAvailable SinceJune 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDB4280
Plasmid#98699PurposeA Cas9-encoding plasmid containing the 5' portion of the ura4 marker and the rrk1 promoter/leader. When linearized by NotI, it serves as the gapped vector in the split-ura4 systemDepositorInsertCas9
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only