We narrowed to 173,019 results for: addgene
-
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
miReporter-PGK
Plasmid#82477PurposemicroRNA reporter relying on a bidirectional PGK promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
GalToxBFP
Plasmid#68073Purposemammalian expression of GC localized oxBFPDepositorInsertGalT signal anchor transmembrane domain
TagsmoxBFPExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
15x-QUAS-dTomato-T2A-GCaMP6s
Plasmid#130666PurposeQUAS reporter line that expresses cytosolic dTomato and the GCaMP6s calcium indicator, separated by T2ADepositorInsert15xQUAS-dTomato-T2A-GCaMP6s
UseAe. aegypti expressionExpressionInsectPromoter15xQUAS-TATAAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
piRFP_SeV_Phosphoprotein
Plasmid#228807PurposeExpression of Sendai virus PhosphoproteinDepositorInsertPhosphoprotein
TagsiRFP670ExpressionMammalianAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSNAPf-Nup43
Plasmid#98276Purposemammalian expression of SNAPf-Nup43DepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSADdeltaG-GFP-F2
Plasmid#32635DepositorInsertGFP
UseRabies virusExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-tTR-KRAB
Plasmid#11642PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hPGK promoter) - AND/OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInsertmPGK, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDIRE
Plasmid#26745DepositorInsertiCre expression cassette
UseCre/Lox; Flp/frtExpressionMammalianAvailable SinceJan. 10, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLVET-tTR-KRAB
Plasmid#11644PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hEF-1alpha promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInserthEF-1alpha, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pPE4max-Blasticidin
Plasmid#194905PurposeExpressing prime editing PE4max proteins, to work in conjunction with an epegRNA encoding plasmid or Circular Vector as described in the cited article.DepositorInsertBSD
ExpressionMammalianPromoterCMVAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-VSVgSS-SNAP-TM
Plasmid#207319PurposeFunctional incorporation of SNAP-tag into envelope of virionsDepositorInsertSNAP-tag
ExpressionMammalianPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRH2521
Plasmid#84380PurposeExpression of sgRNA from a imyc promoter (Pimyc)DepositorInsertsgRNA cloning site
UseCRISPRExpressionBacterialAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVPRT-tTR-KRAB
Plasmid#11648PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hPrion promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInserthPrion, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGKO2-Gateway
Plasmid#63618Purposea binary Agrobacterium vector carrying a modified HSVtk gene as a negative selection marker against ectopic transformants. Uses Gateway cloning.DepositorTypeEmpty backboneUseFungal expressionAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lys-eMagA-EGFP
Plasmid#162246PurposeBlue-light dependent heterodimerization systemDepositorInsertp18-eMagA-EGFP
ExpressionMammalianAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBEVY-L
Plasmid#51226Purposebi-directional expression vector for yeast, constitutively active, LEU2 selectionDepositorTypeEmpty backboneExpressionYeastPromoterGPD/ADH1Available SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only