We narrowed to 9,360 results for: CAG
-
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only
-
-
pPN262
Plasmid#91607PurposeExpress sgRNA targeting human EPHX2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAH-MIBP16
Plasmid#51870PurposeExpresses C-terminal HA-tagged full length rat MIBP1 (cloned into pCAGGS)DepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_3
Plasmid#36337DepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
WNK4 gRNA (BRDN0001147338)
Plasmid#75656Purpose3rd generation lentiviral gRNA plasmid targeting human WNK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146750)
Plasmid#77280Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK6 gRNA (BRDN0001148151)
Plasmid#76258Purpose3rd generation lentiviral gRNA plasmid targeting human NEK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN287
Plasmid#91670PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PAK4 gRNA (BRDN0001146148)
Plasmid#77574Purpose3rd generation lentiviral gRNA plasmid targeting human PAK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
shMYB-2
Plasmid#247031PurposeUsed for a knockdown of MYB in human Megakaryocyte/Erythroid ProgenitorsDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 UROS_sg2
Plasmid#244874PurposeKnockout of human UROSDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR ATP23 sg1
Plasmid#244847PurposeKnockout of human ATP23DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_2b)-PGKpuro2ABFP-W
Plasmid#208430PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-73kb-DSF
Plasmid#227499Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 73kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-48kb-DSF
Plasmid#227495Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 48kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-USF
Plasmid#227467Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-25kb-USF
Plasmid#227468Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 25kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-1-6
Plasmid#227470Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-40kb-USF
Plasmid#227460Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 40kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-36kb-USF
Plasmid#227461Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-33kb-USF
Plasmid#227465Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 33kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-20kb-USP
Plasmid#227446Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 20kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circRERE_3
Plasmid#215227PurposeSupression of shcircRERE(4-10)_2 expressionDepositorInsertcircRERE shRNA 3 (RERE Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-2
Plasmid#230082PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-2
Plasmid#230084PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-3
Plasmid#230085PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-AntiHer2-LC122-TAG
Plasmid#226839PurposeContains trastuzumab with a TAG codon at position 122 of the light chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 122 of light chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-HC121-TAG
Plasmid#226836PurposeContains trastuzumab with a TAG codon at position 121 of the heavy chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 121 of heavy chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-HC197-TAG
Plasmid#226838PurposeContains trastuzumab with a TAG codon at position 197 of the heavy chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 197 of heavy chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crBACH1-array_EF1a-BFP
Plasmid#224787PurposeBACH1 targeting crRNA array for RfxCas13d expressed from multiple hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrBACH1-1, crBACH1-2, crBACH1-3,
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pAPM-miR30-HNRNPR-ts1
Plasmid#174253PurposeHNRNPR knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 MMP2 g1
Plasmid#170824PurposePiggyBac Cas13d sgRNA plasmid for MMP2 knockdownDepositorInsertCas13d MMP2 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g1
Plasmid#170826PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA242
Plasmid#215943PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v1 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-hcr5
Plasmid#193661PurposeExpression of tandem pre-sgRNA array hcr5 for LbCas12aDepositorInsertU6-DNMT3B-sgRNA-KLF4-sgRNA-TET1-sgRNA-PRR5L-sgRNA-CFTR-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
DRD2-V2tail-TevN-BLITz-TetR-FKBP
Plasmid#210514Purposeexpresses DRD2-V2tail-TevN-BLITz-TetR-FKBP component in mammalian cellsDepositorInsertDRD2-V2tail-TevN-BLITz-TetR-FKBP
TagsHA signal FALGExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFB2gRNA12
Plasmid#196106PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-NDUFB5_sgRNA1
Plasmid#201606PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertNDUFB5 (NDUFB5 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shTgm5-2
Plasmid#180395PurposeProducing AAV that encodes mouse Tgm5 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v1-mU6-sgCebpb_v1-hU6-sgCebpd_v1
Plasmid#177257PurposeExpresses Cebpa_v1 (bU6), Cebpb_v1 (mU6), Cebpd_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpb_v1/sgCebpd_v1
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_E3-3
Plasmid#124484PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_E3-3_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only