We narrowed to 6,111 results for: KIT
-
Plasmid#178987PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Hygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS848∙CsR
Plasmid#199240PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJW1836
Plasmid#154337PurposePromoter reporterDepositorInsertSV40 NLS::mScarlet_I::PEST (dpi)::-tbb-2 3'UTR
ExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3044(gRNA XI-2)
Plasmid#73286PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB3046(gRNA XI-5)
Plasmid#73288PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE5
Plasmid#79461PurposesgRNA shuttle vector; module 1DepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBBK01 pCAS-Tyr-[gRNA: BsaI GFP dropout] (KanR, AmpR)
Plasmid#178985PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Kanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB1975 (pUC19-PTEF1-PPGK1)
Plasmid#73296PurposeExample plasmid containing a bidirectional promoterDepositorInsertpTEF1-pPGK1
UseSynthetic BiologyExpressionBacterial and YeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLSU4cg10
Plasmid#126078PurposePlant transformation vector for stable expression of plastid targeted GFP1-10 in plant cellsDepositorInsertChloroplastic FNR transit peptide
UseBinaryTagsGFP1-10ExpressionPlantPromoterlongCaMV35SAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSW554 - pOp5:SP-mVenus-HDEL
Plasmid#116006Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpOp5:SP(ER)-mVenus-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3048(gRNA XII-2)
Plasmid#73290PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-29b(+)_His-CBD-3C-EmPNGaseF
Plasmid#218193PurposeBacterial expression of a His-tagged Chitin Binding fusion of Elizabethkingia miricola PNGaseFDepositorInsertPNGaseF
TagstufA-His-CBD-3CExpressionBacterialMutationcodon optimized Ecoli, residues 41-354PromoterT7Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hTGFa
Plasmid#199236PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorInsertTransforming growth factor alpha, partial (TGFA Human)
TagsTrxA-6xHis-S-tagExpressionBacterialPromoterT7Available SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMM0641
Plasmid#129006PurposeIntegration vector for optogenetic machinery (pMEDIUM-VP16-CIB1/pMEDIUM-ZCRY2PHR) and pZF-mRUBY2DepositorInsert5' URA3-pRPL18B-SV40NLS-VP16-CIB1-tENO1-pRPL18B-SV40NLS-ZiF268DBD-CRY2PHR-tSSA1-pZF(BS)-mRUBY2-tADH1-URA3 URA3 3'-KanR-ColE1
ExpressionYeastAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVL47 - pSCR>>
Plasmid#116013Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpSCR:GR-LhG4:tSCR:F-H adapter-H-A adapter::pOp4:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVL46 - pWOX4>>
Plasmid#116012Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpWOX4:GR-LhG4:tWOX4:F-H adapter-H-A adapter::pOp4:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only