We narrowed to 3,402 results for: aaas
-
Plasmid#190793PurposeTemplate vector to amplify single sgRNAs or pieces for multiplexing arrays. Has flanking BsaI-sites.DepositorInsertsgRNA (dummy)
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDAS12230_pegRNA-PEAR-GFP(10PBS-24RT)-mCherry
Plasmid#177182Purposeplasmid expressing a pegRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertpegRNA targeting the PEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-tetO-CTR1-shRNA
Plasmid#53180PurposeExpresses shRNA against human CTR1 from puromycin resistance retroviral vectorDepositorAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
His_Naa80d in pTYB12
Plasmid#188455PurposeExpress in E. coli human Naa80 delta (actin's N-terminal acetyl transferase) with N-terminal intein-chitin binding domain tag and 6xHis tag.DepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xControlgRNA
Plasmid#224583PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-his-HYB
Plasmid#64333Purposehis3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of his3 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
shLacZ
Plasmid#42559DepositorInsertshLacZ
UseLentiviral and RNAiExpressionMammalianAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBB75-ncRNA
Plasmid#194087PurposeExpresses Ec86 ncRNA in Escherichia coliDepositorInsertEc86 ncRNA
PromoterT7Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-mSlug-4
Plasmid#40648DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTC364
Plasmid#91213Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, Csy4 processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 3782
Plasmid#31979DepositorAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSUPER IKKbeta
Plasmid#26209DepositorInsertpSUPER IKK beta (IKBKB Human)
UseRNAiAvailable SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-mSlug-3
Plasmid#40647DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pYJ34-PB-CRISPR-BANCR-E1-gRNA
Plasmid#131077Purposelong non-coding RNA BANCR knock outDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHS1182
Plasmid#205964PurposeNZ_CP025815 DinG HNH crRNA expression in pCOLADuet-1DepositorInsertDinG HNH crRNA
ExpressionBacterialPromoterT7Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-SETin-FLAG-HA
Plasmid#24999DepositorInsertSET (SET Human)
TagsFLAG and HAExpressionMammalianMutationsilent mutations introduced to prevent siRNA targ…Available SinceAug. 9, 2010AvailabilityAcademic Institutions and Nonprofits only -
pT2SCb
Plasmid#59385PurposeTemplate plasmid for amplification of a selection cassette that includes two transcription terminator elements, an I-SceI site and a modified chloramphenicol resistance gene.DepositorInsertTT-ISceI-cat2
UseTemplateMutationThe 3’-end of the chloramphenicol resistance gene…Available SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shTGFBR3 puro
Plasmid#58696PurposeLentiviral shRNA vector for knockdown of human TGFBR3DepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only