We narrowed to 13,968 results for: SHI
-
Plasmid#209253PurposeMammalian expression of ATP8B1 mutant E234QDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCAG/ATP8B1(E234Q)-HA
Plasmid#209241PurposeMammalian expression of ATP8B1 mutant E234QDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a LZ control-FLAG
Plasmid#199678PurposeBacterial expression of Leucine Zipper (LZ) control-FlagDepositorInsertLeucine zipper control
Tags6xHis and FlagExpressionBacterialPromoterT7 promoterAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-siRNAres-V5His6_I
Plasmid#146586PurposeInsect Expression of DmPABPC1-siRNAresDepositorInsertDmPABPC1-siRNAres (pAbp Fly)
ExpressionInsectMutationseven silent mutations compared to the sequence g…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-EBM1-2mut-siRNAres_K
Plasmid#146751PurposeMammalian Expression of HsSmg6-EBM1-2mut-siRNAresDepositorInsertHsSmg6-EBM1-2mut-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent and two non silent R291P, N341T mutati…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-EBM1mut-siRNAres_K
Plasmid#146752PurposeMammalian Expression of HsSmg6-EBM1mut-siRNAresDepositorInsertHsSmg6-EBM1mut-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-EBM2mut-siRNAres_K
Plasmid#146753PurposeMammalian Expression of HsSmg6-EBM2mut-siRNAresDepositorInsertHsSmg6-EBM2mut-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsGIDRB86-EBMmut_K
Plasmid#146762PurposeMammalian Expression of HsGIDRB86-EBMmutDepositorInsertHsGIDRB86-EBMmut (C10orf28 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsGIDRP86_K
Plasmid#146763PurposeMammalian Expression of HsGIDRP86DepositorInsertHsGIDRP86 (C10orf28 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsR3HCC1_39-480-EBMmut_K
Plasmid#146765PurposeMammalian Expression of HsR3HCC1_39-480-EBMmutDepositorInsertHsR3HCC1_39-480-EBMmut (R3HCC1 Human)
ExpressionMammalianMutationsequence extracted from BC050572.1; 39-480 trunca…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del42-58-siRNAres_K
Plasmid#146749PurposeMammalian Expression of HsSmg6-del42-58-siRNAresDepositorInsertHsSmg6-del42-58-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6_1-1238-siRNAres_I
Plasmid#146552PurposeMammalian Expression of HsSmg6_1-1238-siRNAresDepositorInsertHsSmg6_1-1238-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del577-816_I
Plasmid#146554PurposeMammalian Expression of HsSmg6-del577-816DepositorInsertHsSmg6-del577-816 (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-siRNAres_I
Plasmid#146556PurposeMammalian Expression of HsSmg6-siRNAresDepositorInsertHsSmg6-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg6_1-576_I
Plasmid#146557PurposeMammalian Expression of HsSmg6_1-576DepositorInsertHsSmg6_1-576 (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg6_1-1238-siRNAres_I
Plasmid#146558PurposeMammalian Expression of HsSmg6_1-1238-siRNAresDepositorInsertHsSmg6_1-1238-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and one non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg6-del577-816_I
Plasmid#146563PurposeMammalian Expression of HsSmg6-del577-816DepositorInsertHsSmg6-del577-816 (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg6-siRNAres_I
Plasmid#146565PurposeMammalian Expression of HsSmg6-siRNAresDepositorInsertHsSmg6-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pN1-HsSmg6_1-576-V5-SBP-MBP_I
Plasmid#146569PurposeMammalian Expression of HsSmg6_1-576DepositorInsertHsSmg6_1-576 (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CLC-SNAP
Plasmid#193580PurposeExpresses human Clathrin Light Chain B tagged with SNAP-tag and mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsSNAP-tag and mEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-nCLC
Plasmid#193564PurposeExpresses human Clathrin Light Chain B (neuronal isoform) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationNeuronal isoformPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
nCLC-ShadowY
Plasmid#193565PurposeExpresses human Clathrin Light Chain B (neuronal isoform) tagged with ShadowY in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsShadowYExpressionMammalianMutationNeuronal isoformPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-CLC
Plasmid#193567PurposeExpresses human Clathrin Light Chain B tagged with FKBP and mEGFP in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-FKBP-EGFP
Plasmid#193572PurposeExpresses human Clathrin Light Chain B tagged with FKBP and mEGFP in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-ShadowY-CLC
Plasmid#193552PurposeExpresses mouse Clathrin Light Chain A tagged with mEGFP and ShadowY in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CLCdeltaN
Plasmid#193562PurposeExpresses human Clathrin Light Chain B truncation mutant (deleted 1-89 aa) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 1-89PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TetO(3G)-GCaMP6f-WPRE
Plasmid#186205PurposeExpress GCaMP6f under TetO(3G)DepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…PromoterTetO(3G)Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-IpgD
Plasmid#183672PurposeInducible Shigella flexneri IpgD for expression in yeastDepositorInsertIpgD
ExpressionYeastPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Topo-Tbxas1_ISH_S
Plasmid#170307PurposeEncoding partial sense strand of the mouse Tbxas1 gene for in situ hybridization.DepositorInsertPartial sense strand of the mouse Tbxas1 gene for in situ hybridization
UseFor ivfAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Topo-Tbxas1_ISH_AS
Plasmid#170308PurposeEncoding partial anti-sense strand of the mouse Tbxas1 gene for in situ hybridizationDepositorInsertPartial anti-sense strand of the mouse Tbxas1 gene for in situ hybridization
UseFor ivfAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1-RNF169UBD
Plasmid#119009PurposeMammalian expression of a fusion protein of human BRCA1 with the human RNF169 Ubiquitin binding domain and BFP expressionDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1-Rad18UBD
Plasmid#119008PurposeMammalian expression of a fusion protein of human BRCA1 with human Rad18 Ubiquitin binding domain and BFP expressionDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMinDis.X513-iNicSnFR3b-(V7)-ER
Plasmid#125123PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotine, termed iNicSnFRs thus enabling optical subcellular pharmacokinetics for nicotineDepositorInsertiNicSnFR3a-(V7)-ER
TagsFusion protein -Endoplasmic retention motifExpressionMammalianPromoterT7Available SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHHM.X513-iNicSnFR3a-(CC93)
Plasmid#124880PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotine, termed iNicSnFRs thus enabling optical subcellular pharmacokinetics for nicotineDepositorInsertiNicSnFR3a-(CC93)
TagsHA Tag and His TagExpressionBacterialMutationNAPromoterT7Available SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHHM.X513-iNicSnFR2-(CC90)
Plasmid#124836PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotine, termed iNicSnFRs thus enabling optical subcellular pharmacokinetics for nicotineDepositorInsertiNicSnFR2-(CC90)
TagsHA tags and His TagExpressionBacterialMutationNAPromoterT7Available SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-KSR R615H
Plasmid#118332PurposeExpression of mouse KSRDepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAD-hRubicon
Plasmid#64144PurposeFor yeast two hybridDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
LV-CMV-Cer-FL- Bmal L95E
Plasmid#47374PurposeBmal full length with cer tag used for mutationDepositorAvailable SinceJan. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-HA/Bmal F423R/V435R/W427R
Plasmid#47351PurposePcHA-Bmal backbone used for the above mutation. Ref.Genes & Dev 17:1921-1932 2003DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L113E
Plasmid#47356PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L113EPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN F122D
Plasmid#47357PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, F122DPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN W284A
Plasmid#47358PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, W284APromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN V315R
Plasmid#47359PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, V315RPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L115E
Plasmid#47377PurposeBmal fragment cloned with Venus tag used for mutationDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L57E
Plasmid#47354PurposeClock fragment mutatation tagged with VenNDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L57EPromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Gb2-K
Plasmid#25759PurposeEntry vector with human U6 promoter driving both mouse G alpha 12 and G alpha 13 miR30-based shRNAs.DepositorInsertGb2 miR-shRNA (Gnb2 Mouse)
UseEntry vectorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET28aAviHisCD72aCTLD
Plasmid#129065Purposegeneration of biotinylated mouse CD72a CTLD protein using bacteriaDepositorInsertCD72a (Cd72 Mouse)
ExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-FUSN-mCh-Cry2WT
Plasmid#101223PurposeFUS(1-214) fused to mCh-Cry2WTDepositorAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only