We narrowed to 14,985 results for: GRN

#107330

U6 driven SaCas9 sgRNA expression for VEGFA site 3

Scot Wolfe

Bolukbasi et al Nat Commun. 2018 Nov 19;9(1):4856. doi:

Nov. 15, 2018

Academic Institutions and Nonprofits only

#113132

Expresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)

Dominik Niopek

Bubeck et al Nat Methods. 2018 Oct 30. pii: 10.1038/s

Nov. 1, 2018

Academic Institutions and Nonprofits only

#100557

Expresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGC

Dustin Maly

Rose et al Nat Methods. 2017 Jul 24. doi: 10.1038/n

Sept. 27, 2017

Academic Institutions and Nonprofits only

#89957

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#89953

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting rpsL.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#89951

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting malG.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#87396

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87405

p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#68807

specific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.

Constance Ciaudo

Bodak et al FEBS Open Bio. 2017 Jan 11;7(2):204-220.

Feb. 13, 2017

Academic Institutions and Nonprofits only

#68808

specific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of

Constance Ciaudo

Bodak et al FEBS Open Bio. 2017 Jan 11;7(2):204-220.

Feb. 13, 2017

Academic Institutions and Nonprofits only

#81218

pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch13 reporter

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#81221

pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the upstream region of FAM19A2 locus

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#233078

Expression vector for sgRNA-S1b and eCas12f1

Kyoungmi Kim

Park et al Nat Commun. 2025 Jan 15;16(1):677. doi:

April 25, 2025

Academic Institutions and Nonprofits only

#195546

dCas12a gRNA expression backbone

Michael Bassik

Tycko et al Nat Biotechnol. 2024 Nov 1. doi: 10.1038

May 6, 2024

Academic Institutions and Nonprofits only

#158987

Vector D encodes pAAV-pMecp2-dSaCas9-VP160-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neurons

Chung Tin

Lau et al Mol Ther Nucleic Acids. 2019 Jun 7;16:63

Aug. 29, 2020

Academic Institutions and Nonprofits only

#92102

Expression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence)

Ervin Welker

Kulcsar et al Genome Biol. 2017 Oct 6;18(1):190. doi:

Oct. 31, 2017

Academic Institutions and Nonprofits only