We narrowed to 19,130 results for: Tat
-
Plasmid#137908PurposeFor incorporation of fluorophenylalanine derivativesDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialMutationContaining N346A, C348S mutationsPromoterpBADAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-let-7 MT
Plasmid#78261PurposepsiCHECK2 dual luciferase reporter harboring a mutated let-7 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorInsertmutated let-7 target site
UseLuciferase; Microrna activityExpressionMammalianMutationnucleotides 2-5 and 10-11 changed from CTCC to GA…Available SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
MyoD-pCLBabe
Plasmid#20917DepositorAvailable SinceApril 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCMV Lex VP16 HA (P#1708)
Plasmid#14593DepositorInsertLexA
TagsHA and VP16ExpressionMammalianAvailable SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
SPACE-NG (pRZ5150)
Plasmid#140244PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_NG-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_NG
ExpressionMammalianMutationV82G in TadA*, NG mutations in SpCas9, D10A in Sp…PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR_L1-miniTurbo-YFP-NLS-STOP-L2
Plasmid#127362Purposegateway entry vector for expressing nuclear miniTurbo-YFP under a promoter of choiceDepositorInsertminiTurbo (BirA mutant)
UseGateway CloningTagsGS linker, NLS, V5, and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Promoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-R2505P
Plasmid#69015Purposeactivating MTOR mutationDepositorInsertMTOR-R2505P (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Arginine 2505 to ProlineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-I2500F
Plasmid#69014Purposeactivating MTOR mutationDepositorInsertMTOR-I2500F (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Isoleucine 2500 to PhenylalanineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLIM-AKAR
Plasmid#63058PurposeExpresses the Fluorescence Lifetime Imaging Microscopy (FLIM)-compatible PKA activity sensor FLIM-AKAR in an AAV backboneDepositorInsertFLIM-AKAR
UseAAVExpressionMammalianPromoterEF-1αAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CaMKIIa-hChR2(C128S)-EYFP-WPRE
Plasmid#20294PurposeLentiviral expression of ChR2 (C128S) Step Function Opsin (SFO) fused to EYFP, for bi-stable optogenetic excitationDepositorInsertchannelrhodopsin-2
UseLentiviralTagsEYFPExpressionMammalianMutationchanged Cysteine 128 to SerineAvailable SinceMay 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CFLAR_WT_V5
Plasmid#82936PurposeGateway Donor vector containing CFLAR, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
BD2
Plasmid#37486DepositorInsertloxP-PGK-Hyg-loxP
UseIpsc gene targetingPromoterPGKAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLIK sh human Rb 1534 hyg
Plasmid#31500DepositorInsertRB shRNA (RB1 Human)
UseLentiviral and RNAiTagsEGFPExpressionMammalianMutationThe target sequence for shRB 1534 is GAACGATTATCC…Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
HA-ISceID44A
Plasmid#59424PurposeExpresses a catalytically inactive form of the endonuclease ISceIDepositorInsertendonuclease ISceI mutant (I-SceI )
TagsHA tagExpressionMammalianMutationchanged aspartate 44 to alanine (D44A)Available SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETconNK
Plasmid#81169PurposepETconNK Empty BackboneDepositorTypeEmpty backboneTagsc-mycExpressionBacterial and YeastPromoterGAL1Available SinceFeb. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
Eef1a-1955/-1>nls::Cas9::nls
Plasmid#59987PurposeEef1a (EF1alpha) promoter driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Eef1a (EF1alpha) -1955/-1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBiFCt-2in1-CN
Plasmid#105113Purposeratiometric BiFC analysis in plants (transient transformation)DepositorTypeEmpty backboneTagscYFP-HA and nYFP-MycExpressionPlantAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ151
Plasmid#69302PurposeGateway entry vector with pcoCas9D10ADepositorInsertpcoCas9D10A (Plant codon-optimized)
UseCRISPRTags2XFLAGMutationD10A mutation; NLS fusionAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only