We narrowed to 41,264 results for: Tro
-
Plasmid#47614Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZExpressionMutation714 bp from 3' end of 2nd intronPromoterHSV tk promoterAvailable sinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-TetR
Plasmid#103797PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorUseTagsExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmKikGR Actin
Plasmid#105315PurposePhotoconvertable cytoskeletal protein actin to study kinetics or dynamicsDepositorInsertactin beta (ACTB Human)
UseTagsKikGRExpressionMammalianMutationPromoterAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPHR-mCherry-NLS-VP16
Plasmid#103821PurposeSoluble BLInCR transcription activator (transactivation domain of viral VP16 protein) that is recruited to 'localizer' sites upon blue light illuminationDepositorInsertPHR-mCherry-VP16 (CRY2 Mustard Weed)
UseTagsExpressionMammalianMutationVP16: G126T (silent, G42G)PromoterCMVAvailable sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hPMLIII
Plasmid#103808PurposeBLInCR 'Localizer' construct that marks the PML nuclear bodies and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorUseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
nes1852tk/lacZ
Plasmid#47613Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZExpressionMutation2nd intron onlyPromoterHSV tk promoterAvailable sinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPHR-iRFP713-NLS-VP16
Plasmid#103823PurposeSoluble BLInCR transcription activator (transactivation domain of viral VP16 protein) that is recruited to 'localizer' sites upon blue light illuminationDepositorInsertPHR-iRFP713-VP16 (CRY2 Mustard Weed)
UseTagsExpressionMammalianMutationVP16: G126T (silent, G42G)PromoterCMVAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-hPMLIII
Plasmid#103825PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorUseTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-TetR-tagRFP-T
Plasmid#103809Purpose'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorUseTagsExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-TetR
Plasmid#103798PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorUseTagsExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMY-Lyz2-GSG-mVenus
Plasmid#163348PurposeRetroviral vector to express C-terminally mVenus-tagged murine Lyz2DepositorInsertLyz2 (Lyz2 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterLTRAvailable sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-Lyz2-GSG-mTurquoise
Plasmid#163347PurposeRetroviral vector to express C-terminally mTurquoise2-tagged murine Lyz2DepositorInsertLyz2 (Lyz2 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterLTRAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-NHL only-LIN-41
Plasmid#52723Purposeretroviral expression of human LIN-41 / TRIM71 containing only the NHL repeats and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationNHL-only contains only an initiating methionine a…PromoterAvailable sinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-7CtoA-LIN-41
Plasmid#52726Purposeretroviral expression of human LIN-41 / TRIM71 containing cysteine to alanine point mutations of all 7 cysteines in the RING domain and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationchanged cysteines 12, 15, 61, 66, 69, 91, and 94 …PromoterAvailable sinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
UseTagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-HIPK3 Exon
Plasmid#69888PurposeExpresses the human HIPK3 exon 2 circular RNA in DrosophilaDepositorInsertHIPK3 (HIPK3 Human, Fly)
UseTagsExpressionInsectMutationExpresses aa1-194 of HIPK3PromoterMetallothionein Promoter (pMT)Available sinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-NLS-VP16
Plasmid#103822PurposeSoluble BLInCR transcription activator (transactivation domain of viral VP16 protein) that is recruited to 'localizer' sites upon blue light illuminationDepositorInsertPHR-EYFP-VP16 (CRY2 Mustard Weed)
UseTagsExpressionMammalianMutationVP16: G126T (silent, G42G)PromoterCMVAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaTagsExpressionMutationPromoterAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only