We narrowed to 14,145 results for: TIM
-
Plasmid#77373Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PRKD1 gRNA (BRDN0001144834)
Plasmid#77230Purpose3rd generation lentiviral gRNA plasmid targeting human PRKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-FRT-TO-SSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)_P2A_iLID-mCherry-RAB11
Plasmid#174647PurposeOptogenetic coupling of RAB11 to tetramerized moss kinesin-14 to induce retrograde transport of recycling endosomes. Compatible with Flp-in TREX system.DepositorInsertSSPB(micro)-mVenus-GCN4-ppKin14Vib(816-1321)-P2A-iLID-mCherry-RAB11
ExpressionMammalianMutationSSPB:Arg73Gln; mVenus: Met1Del, Thr154Met; ppKin1…PromoterCMV (with TetOn)Available SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS04 [myo-3p::bPGC::SL2::mCherry]
Plasmid#168172PurposeExpression of bPGC in BWMs of C. elegansDepositorInsertbPGC
ExpressionWormAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIK2 gRNA (BRDN0001149208)
Plasmid#77138Purpose3rd generation lentiviral gRNA plasmid targeting human SIK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPHR-iRFP713-NLS-VP16
Plasmid#103823PurposeSoluble BLInCR transcription activator (transactivation domain of viral VP16 protein) that is recruited to 'localizer' sites upon blue light illuminationDepositorInsertPHR-iRFP713-VP16 (CRY2 Mustard Weed)
ExpressionMammalianMutationVP16: G126T (silent, G42G)PromoterCMVAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
MO91-ORAI1N223A-TEV-pHluorin (ORAI1-EC-pHluorin)
Plasmid#174336PurposeThe ORAI1N223A mutant containing-TEV-pHluorin-TEV sequence in the extracellular loop 2DepositorInserthuman Orai1 (ORAI1 Human)
UseRetroviralTagspHluorin inserted in the extracellular loop 2 of …ExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIK1 gRNA (BRDN0001145248)
Plasmid#77895Purpose3rd generation lentiviral gRNA plasmid targeting human SIK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBabe JunD-Venus puro
Plasmid#58496Purposemammalian expression of Venus-tagged mouse JunDDepositorAvailable SinceAug. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
NADK2 gRNA (BRDN0001146214)
Plasmid#78091Purpose3rd generation lentiviral gRNA plasmid targeting human NADK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPHR-mCherry-NLS-VP16
Plasmid#103821PurposeSoluble BLInCR transcription activator (transactivation domain of viral VP16 protein) that is recruited to 'localizer' sites upon blue light illuminationDepositorInsertPHR-mCherry-VP16 (CRY2 Mustard Weed)
ExpressionMammalianMutationVP16: G126T (silent, G42G)PromoterCMVAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
CFP-GIV-CT FA
Plasmid#69533PurposeMammalian expression of The CFP-tagged GIV-CT-FA biosensorsDepositorInsertGIV (CCDC88A Human)
TagsCFPExpressionMammalianMutationC terminal amino acids S1660-S1870 of human GIV w…PromoterCMVAvailable SinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001144776)
Plasmid#75754Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001148297)
Plasmid#75755Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001148836)
Plasmid#75756Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001149197)
Plasmid#75757Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CFP-GIV-CT WT
Plasmid#69532PurposeMammalian expression of The CFP-tagged GIV-CT biosensorsDepositorInsertGIV (CCDC88A Human)
TagsCFPExpressionMammalianMutationC terminal amino acids S1660-S1870 of human GIVPromoterCMVAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FRT-TO-FH-Nsp7-Nsp8_GC3opt
Plasmid#157692Purposemammalian expression of N-terminally Flag-His8 tagged Nsp7-Nsp8 fusion protein under control of a tetracycline-inducible promoterDepositorInsertFH-Nsp7-Nsp8_GC3opt (ORF1ab SARS-CoV-2)
TagsFlag-His8ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
TRIB2 gRNA (BRDN0001148332)
Plasmid#75604Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RFK gRNA (BRDN0001146181)
Plasmid#76847Purpose3rd generation lentiviral gRNA plasmid targeting human RFKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RFK gRNA (BRDN0001162491)
Plasmid#76850Purpose3rd generation lentiviral gRNA plasmid targeting human RFKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
RIPK2 gRNA (BRDN0001146083)
Plasmid#76910Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK1 gRNA (BRDN0001487095)
Plasmid#77893Purpose3rd generation lentiviral gRNA plasmid targeting human SIK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK1 gRNA (BRDN0001146021)
Plasmid#77894Purpose3rd generation lentiviral gRNA plasmid targeting human SIK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148481)
Plasmid#75499Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc enAspCas12a
Plasmid#182127PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc enAspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc enAspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
TTBK2 gRNA (BRDN0001147885)
Plasmid#77968Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SYK gRNA (BRDN0001146072)
Plasmid#76777Purpose3rd generation lentiviral gRNA plasmid targeting human SYKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK2 gRNA (BRDN0001147148)
Plasmid#77140Purpose3rd generation lentiviral gRNA plasmid targeting human SIK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGK-hMIGA2-DsRed
Plasmid#192867PurposeExpress codon-optimized human MIGA2 full length with a C-terminal DsRed tag in mammalian cellsDepositorInsertCodon-optimized human Mitoguardin 2 (MIGA2 Human)
TagsDsRedExpressionMammalianPromoterPGKAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
KA2880_pPB-TREtight-FLAG-Esrrb-InO
Plasmid#124178PurposepiggyBac-based Dox-inducible expression of FLAG-EsrrbDepositorAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
PIK3CB gRNA (BRDN0001147768)
Plasmid#76194Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME2 gRNA (BRDN0001487089)
Plasmid#77932Purpose3rd generation lentiviral gRNA plasmid targeting human NME2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-B2UP49_GFP
Plasmid#103071PurposeCas9 coding gene template with optimized sequence for human codon usage, also expresses EGFPDepositorInsertB2UP49(Cas9 coding gene from Akkermansia muciniphila (strain ATCC BAA-835))
UseCRISPRExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
PNKP gRNA (BRDN0001147028)
Plasmid#77162Purpose3rd generation lentiviral gRNA plasmid targeting human PNKPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-HA-CAD S1900A
Plasmid#46240PurposeFLAG-HA-CAD with S1900 mutated to alanineDepositorInsertcarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (Cad Mouse)
TagsFLAG and HAExpressionMammalianMutationSerine 1900 changed to Alanine (S1900A)PromoterCMVAvailable SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146019)
Plasmid#75540Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146281)
Plasmid#75541Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMP108 Nanog-Venus-2a-mCherry
Plasmid#159743PurposeNanog targeting vector to insert fluorescent reporter of protein and gene expression levels from endogenous locus in mouse embryonic stem cells. Please see depositor comments for more detail.DepositorAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTE4567
Plasmid#107557PurposeExpresses human codon optimized inactive MbCpf1(dead2) in mammalian cells.DepositorInserthMbCpf1(dead2)
Tags3xHA and NLSExpressionMammalianMutationE1080APromoterCMVAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
PRKRA gRNA (BRDN0001146443)
Plasmid#76299Purpose3rd generation lentiviral gRNA plasmid targeting human PRKRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc AspCas12a
Plasmid#182122PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc AspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc AspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA5 gRNA (BRDN0001145521)
Plasmid#77372Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-Ly6G-miR30
Plasmid#163358PurposeLentiviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface marker.DepositorAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-hPMLIII
Plasmid#103825PurposeSoluble BLInCR effector that is recruited to 'localizer' sites upon blue light illuminationDepositorAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001487050)
Plasmid#77956Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001145290)
Plasmid#77957Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTBK2 gRNA (BRDN0001487117)
Plasmid#77969Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTBK1 gRNA (BRDN0001145252)
Plasmid#75801Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only