We narrowed to 5,334 results for: pAAV
-
Plasmid#37756PurposeExpresses ChETA-TdTomato in cells lacking Cre (Cre-Off), for optogenetic excitationDepositorInsertChETA-TdTomato
UseAAV and Cre/Lox; Cre-offTagsTdTomatoPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-mDLX-TVA-2A-N2cG
Plasmid#172365PurposeTargeting envA-pseodotyped RVdG-CVS-N2c vectors for specific retrograde labeling from cre-expressing inhibitory neuronsDepositorInsertTVA + B19-N2cG
UseAAV and Cre/LoxExpressionMammalianPromotermDLXAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.1)-CMV-eGFP
Plasmid#194015PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.1)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMV and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-rsChRmine-eYFP-WPRE
Plasmid#183531PurposeOptogeneticsDepositorInsertrsChRmine-eYFP
UseAAVMutationI146M/G174SPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FDIO-IGK-dAPEX2-KDEL
Plasmid#117184PurposePlasmid name in publication: pAAV-FDIO-ER-dAPEX2. Peroxidase reporter for multiplexed electron microscopy labelingDepositorInsertIGK-dAPEX2-KDEL
UseAAV; Flp/frtExpressionMammalianMutationW41F and A134P on soybean APXPromoterEF1aAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-TVA66T-EGFP
Plasmid#64091PurposeExpresses TVA66T-EGFP under the CAG promotorDepositorInsertTVA66T-EGFP
UseAAV and Cre/LoxTagsEGFPExpressionMammalianMutationGlutamic acid 66 to ThreoninePromoterCAGAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
17_pAAV-ProB1-CatCh-GFP-WPRE
Plasmid#125921PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB1Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
107_pAAV-ProC17-CatCh-GFP-WPRE
Plasmid#125952PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC17Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_g5-HT3.0mut
Plasmid#208724PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0mut in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0mut
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP720-P2A-GFP
Plasmid#197165PurposeExpresses the protein of miRFP720-P2A-GFP in mammalian cellsDepositorInsertmiRFP720-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SNIFP-P2A-GFP
Plasmid#197157PurposeExpresses the protein of SNIFP-P2A-GFP in mammalian cellsDepositorInsertSNIFP-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-axon-jYCaMP1s
Plasmid#135421PurposeAxon-targeted yellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfection, slow variantDepositorHas ServiceAAV1InsertjYCaMP1s
UseAAVTagsGAP43 axon targeting sequenceExpressionMammalianPromoterhSynAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
12_pAAV-ProC2-CatCh-GFP-WPRE
Plasmid#125938PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC2Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn intron Psam4GlyR m3m4 HA
Plasmid#196041PurposeAAV for Chemogenetic plasmidsDepositorInsertPsam4GlyR m3m4 HA
UseAAVTagsHAExpressionMammalianPromoterSynapsinAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-mCherry-WPRE
Plasmid#202620PurposeDouble floxed red fluorescent protein mCherry in AAV production vector expressed under the mammalian promoter (EF1a)DepositorInsertmCherry
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO-ChETA-EYFP-WPRE-pA
Plasmid#37086PurposeExpresses ChETA-EYFP in cells lacking Cre (Cre-Off), for optogenetic excitationDepositorInsertChETA-YFP
UseAAV and Cre/Lox; Cre-offTagsEYFPPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG.mCherry-WPRE
Plasmid#127868PurposepAAV plasmid expressing an NOS-IN133.3xFLAG.mCherry fusion protein under the hSyn promoterDepositorInsertNos1 (Nos1 Mouse)
UseAAVTags3xFLAG and mCherryMutationAmino acids 1-133 onlyPromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2
Plasmid#75295PurposeAn AAV packaging vector that expresses eGFP and Kv1.2 under the control of a neuronal promoter.DepositorAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG-WPRE
Plasmid#127861PurposepAAV plasmid expressing an mCherry.3xFLAG fusion protein under the hSyn promoterDepositorInsertmCherry
UseAAVTags3xFLAGPromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only