We narrowed to 11,516 results for: Kars
-
Plasmid#156012PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
plenti-UbcP-FLAG-CRBN-pGK-HYG
Plasmid#107374PurposeLentiviral expression of FLAG-CRBNDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBbA5a-sufABCDSE
Plasmid#195056PurposeExpresses SUF operon from E. coli from IPTG-inducible promoterDepositorInsertsufABCDSE
ExpressionBacterialAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-hMLH1dn for IVT
Plasmid#178114PurposeTemplate for in vitro transcription of human MLH1dnDepositorInserthuman MLH1dn (codon optimized) (MLH1 Human)
UseTemplate for in vitro transcriptionMutationDetailed in manuscriptPromoterT7 (inactivated)Available SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET14b His Rab8a Q67L
Plasmid#186014PurposeHis Rab8a Q67LDepositorInsertHis Rab8a Q67L (RAB8A Human)
ExpressionBacterialAvailable SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneoMyc UNC119B
Plasmid#128333PurposeMammalian expression vector of Myc-tagged human UNC119BDepositorAvailable SinceOct. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-ETV2
Plasmid#225051PurposePiggyBac vector encoding doxycycline-inducible codon-optimized human ETV2DepositorInsertETS Variant Transcription Factor 2 (ETV2 Human)
ExpressionMammalianMutationCodon OptimizedPromoterTRE3GAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDF-Frb-v1
Plasmid#201923PurposeE. coli vector expressing FrbA, FrbB, FrbC, FrbD and FrbE for the biosynthesis of non-hydrolyzable phosphoserine from phosphoenolpyruvate.DepositorInsertsFrbA
FrbB
FrbC
FrbD
FrbE
ExpressionBacterialPromoterT7 (modified), T7 (modified, moderate), T7 (modif…Available SinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244102PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHEN-CoV2-nanobody-G6
Plasmid#194589PurposeBacterial expression of G6 nanobody targeting the receptor binding domain (RBD) of SARS-CoV-2 spikeDepositorInsertG6 (S )
ExpressionBacterialAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
SERPINH1
Plasmid#155999PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRPF19
Plasmid#155847PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Venus-G protein Beta2 in pcDNA3.1
Plasmid#42182DepositorAvailable SinceJuly 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
OMM-long-CFAST10
Plasmid#233598PurposeExpression of CFAST10 on the OMM membrane after a long linkerDepositorInsertCFAST10
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY1462_SERPINA1_CCA32_Caspase
Plasmid#193194PurposeExpress Caspase conditional upon RNA transcriptDepositorInsertiCaspase9 (CASP9 Human)
ExpressionMammalianAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
SFG.wtCNa_opt.IRES.eGFP
Plasmid#22489DepositorInsertcodon optimised wild type Calcineurin A (PPP3CA Human)
UseRetroviralMutationCodon Optimised wtCNaAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-cMyc T58A
Plasmid#20075DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
PRPF3
Plasmid#155848PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEFIRES-P-ACSL3-mCherry
Plasmid#87158PurposeFluorescent protein targeted to lipid droplets (LDs) from the endoplasmic reticulum (ER)DepositorAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-ER-LAR-GECO1
Plasmid#61244PurposeExpresses LAR-GECO1 in the endoplasmic reticulum in mammalian cellsDepositorInsertLAR-GECO1
TagsER-retention sequence: KDEL and ER-targeting sequ…ExpressionMammalianMutationSubstitutions relative to R-GECO1: V51W/I113V/N35…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEGFP-WT-STAT3
Plasmid#71450PurposeRetroviral expression of WT-STAT3. Please note that this plasmid contains WT-STAT3 tagged with FLAG, not GFP.DepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAX198
Plasmid#173042PurposeCustom vector for sgRNA library constructionDepositorInsertHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR (HBB Human)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244092PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
SNW1
Plasmid#156034PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-SOCS1
Plasmid#174571PurposeHuman HA-tagged SOCS1 expression (N-term. tag) (CMV prom.)DepositorInsertHA-SOCS1
ExpressionMammalianPromoterCMVAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCB’ CbbL Y72R
Plasmid#162707PurposeCarboxysome operon with point mutation to CbbL, prk; Substitution of CsoS2-binding tyrosine with arginine prevents rubisco encapsulation creating rubisco-less carboxysomesDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutationCbbL Y72R; Substitution of CsoS2-binding tyrosine…PromoterPLtet0-1 promoterAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Plenti-ARE-HSVTK-luc
Plasmid#161789PurposeExpresses HSV-TK and Luciferase in an NRF2 dependent manner. Also, expresses cherry and blasticidin resistance selection markersDepositorInsertsLuciferase-T2A-HSV-TK
mCherry P2A blasticidin
UseLentiviral and LuciferaseExpressionMammalianPromoterEF1a and Murine Gclc AREAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-dual-scafffold-2.0 (pBP49)
Plasmid#218931PurposeThe dual-scaffold for making dual-CRISPR screening libraries or dual-CRISPR plasmids.DepositorInsertdual scaffolds for CRISPR
UseCRISPRAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET15b+His SUMO PPM1H
Plasmid#207333PurposeBacterial expression of His SUMO PPM1HDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDF0114 pU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
Plasmid#172508PurposeEncodes the mature DisCas7-11 DR along with a golden gate site for spacer cloningDepositorInsertpU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mRuby3
Plasmid#244101PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-dCas9-BFP
Plasmid#46910PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFPDepositorInsertdCas9-BFP fusion
UseCRISPR and LentiviralTags2xNLS, BFP, and HAExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9.mCherry
Plasmid#208342PurposeLentivirus with EF1a driven Cas9 linked (P2A) to mCherry.DepositorArticleInsertsCas9
mCherry
UseCRISPR and LentiviralTagsnuclear localization sequence (NLS) and FLAG tagPromoterEF-1aAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only